Maml1

T-lymphoma cell lines were available from American Type Culture Collection (Manassas, VA, USA). Cells were maintained in RPMI-1640 medium, supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin–streptomycin (Sigma-Aldrich, St Louis, MO, USA). Braunschweig, Germany). ShRNA sequence targeting NALT was cloned into lentivirus vector U6-MCS-Ubiquitin-Cherry-IRES-puromycin while the overexpression of NICD was conducted by cloning the coding sequence (CDS) into lentivirus vector PLv-GFP. The γ secretase inhibitors N-[N-(3, 5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester (DAPT) were purchased from Selleck Chemicals (Houston, TX, USA) which was refer in the figures as GSI treated group. Sequence for NALT shRNA: 5′- CACCGGACTACTTCTCGTTTGAAAGCGAACTTTCAAACGAGAAGTAGTCC –3. Sequence for the ASO targeting NALT: 5′ G*C*T*T*C*C*C*T*C*C*T*A*C*T*T*G*C*C*A*G 3′ and the control sequence: 5′ G*C*C*C*A*T*T*C*A*T*T*T*C*C*T*T*C*C*C*G 3′. The stable cells infection was selected by puromycin. After cells treated with lentivirus for 48 h, medium containing puromycin was added and the medium was replaced every 2 days. The primer antibody of NOTCH1, HES1, MAML1, Survivin and GAPDH were purchased from Cell Signal Technology (Boston, MA, USA).

Ara-C and DNR were purchased from the Sigma-Aldrich (St. Louis, MI, USA). NAC, Momordin-Ic and 3-TYP were consumed from Selleckchem (Houston, TX, USA). All compounds, except for in vivo studies, were reconstituted in the DMSO, stored at 100 mM stock concentrations in −80 °C, and used at the indicated doses as suggested by the vendor. Flow cytometry antibodies, Alexa Fluor 647 Rabbit anti-Active caspase 3 and APC-H7 Mouse anti-Human CD45 were purchased from BD pharmingen (San Jose, CA, USA). PE/Cy5 anti-Mouse CD45 (clone 30-F11) was consumed from BioLegend (San Diego, CA, USA). Immunoblotting antibodies, SUMO1, SIRT3, SENP1, Notch Activated Targets Antibody Sampler Kit including Notch1 (FL), MAML1, BPUSH and HES1, p-PI3K p85, t-PI3K p85, p-p38, t-p38, p-AKT and t-AKT were purchased from Cell Signaling Technology (Danvers, MA, USA). Acetylated SOD2 and SOD2 antibodies were purchased from Abcam (London, UK). Tubulin and β-actin antibodies were purchased from Proteintech (Rosemont, IL, USA).