Anti histone h3 acetyl k18

For all staining, cells were blocked with 10% FBS prior to extracellular staining, then, if intracellularly stained, cells were treated with Permeabilization Solution (BD) and stained for intracellular markers in Perm/Wash Buffer (BD). Stains: Hoechst, and antibodies against CD45 (BioLegend, HI30; Tonbo, HI30), CD34 (BioLegend, 581), CD66b (BioLegend, G10F5), pan-Cytokeratin (pCK, Abcam, C-11), SIRT2 (Proteintech, 66410), Anti-histone H3-acetyl K18 (Abcam, 1191), p300 (Santa Cruz, 32244 AF488), acetyl-p300 (Invitrogen, PA5-16185).

WT CD47-low and CD47-null PC3 cells were plated overnight in 6-Well plates. The cells were fixed using Paraformaldehyde solution (Sigma), and chromatin was extracted using Chromatin Isolation kit (Abcam). Genomic DNA was sheared using 34 pulses of 10–12 s each at level by sonication with Disruptor sonication System from (Diagenode). ChIP was performed following instructions from ChIP Kit—One Step (Abcam). The Anti-Histone H3 (tri methyl K27) antibody, Anti-Histone H3 (di methyl K4) antibody and Anti-Histone H3 (acetyl K18) antibodies (Abcam) was incubated overnight for 4°C. The genomic SLFN11 primers were designed by using genomic DNA region of hg38_dna range = chr17:35373531-35374940 using UCSC Genome Browser. The following primers were designed using the Primer 3 program: SLFN-838 (CCGTCACGCTGCTAGTGATA), SLFN-968 (GAGTTGGCCAAAGACAGGAG), SLFN-949 (CTCCTGTCTTTGGCCAACTC), SLFN-1076 (CTCCGCATCAGTGAGAAGTG). SLFN11 level of eluted CHIP-DNA was measured using real-time genomic SLFN11 primers with control GAPDH (Abcam). Enrichment in the ChIP assay was calculated by normalizing to the input.