Organs were kept in RNAlater (Qiagen) after harvesting. RNA was extracted from organ homogenates with the RNeasy Fibrous Tissue Mini Kit (Qiagen), and reverse-transcribed with the iScript cDNA Synthesis kit (Biorad). Viral titers were determined, by qPCR, as absolute levels of the Ie1 gene (F: 5’GAGTCTGGAACCGAAACCGT3’; R: 5’GTCGCTGTTATCATTCCCCAC3’, Sigma) using the SYBR Green Master Mix (Takara). For Il15, Il12 and Il18 gene expression analysis, microfluidic quantitative real-time RT-PCR with the Biomark HD system (Fluidigm) was used. Briefly, pre-amplified cDNA (22 cycles) was diluted fivefold before analysis in a Flex Six IFC (Fluidigm) with Universal PCR Master Mix (Fluidigm) and ready-to-use primer and probe sets pre-developed by Applied Biosystems (TaqMan Gene Expression Assays): IL-15 (Mm00434226_m1), IL-12b (Mm00434174_m1), IL-18 (Mm00434226_m1) and GAPDH as a housekeeper (Mm99999915_g1). Ct values were calculated from the system’s software (BioMark Real-time PCR Analysis; Fluidigm).
Flex six ifc
Manufactured by Standard BioTools
The Flex Six IFC is a microfluidic system designed for versatile experiments. It features six independent fluidic circuits that enable parallel processing and analysis of samples. The Flex Six IFC provides precise control over fluid handling, allowing users to perform a variety of lab-on-a-chip applications.
Automatically generated - may contain errors
Lab products found in correlation
Biomark hd system, by Standard BioTools (3 mentions)
Biomark real time pcr analysis, by Standard BioTools (2 mentions)
Universal pcr master mix, by Standard BioTools (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Takara Bio (2 mentions)
Rnalater, by Qiagen (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (2 mentions)
Surecycler 8800, by Agilent Technologies (1 mentions)
Preamp master mix, by Standard BioTools (1 mentions)
3 protocols using flex six ifc
1
Viral Titers and Cytokine Expression
2
Viral Titers and Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Organs were kept in RNAlater (Qiagen) after harvesting. RNA was extracted from organ homogenates with the RNeasy Fibrous Tissue Mini Kit (Qiagen), and reverse-transcribed with the iScript cDNA Synthesis kit (Biorad). Viral titers were determined, by qPCR, as absolute levels of the Ie1 gene (F: 5’GAGTCTGGAACCGAAACCGT3’; R: 5’GTCGCTGTTATCATTCCCCAC3’, Sigma) using the SYBR Green Master Mix (Takara). For Il15, Il12 and Il18 gene expression analysis, microfluidic quantitative real-time RT-PCR with the Biomark HD system (Fluidigm) was used. Briefly, pre-amplified cDNA (22 cycles) was diluted fivefold before analysis in a Flex Six IFC (Fluidigm) with Universal PCR Master Mix (Fluidigm) and ready-to-use primer and probe sets pre-developed by Applied Biosystems (TaqMan Gene Expression Assays): IL-15 (Mm00434226_m1), IL-12b (Mm00434174_m1), IL-18 (Mm00434226_m1) and GAPDH as a housekeeper (Mm99999915_g1). Ct values were calculated from the system’s software (BioMark Real-time PCR Analysis; Fluidigm).
3
Multiplex qPCR Assay for Phage Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Preamplification (PreAmp) was performed using PreAmp Master Mix (Fluidigm) on a SureCycler 8800 (Agilent Technologies) according to the manufacturer instructions (Fluidigm PN 68000088 K1, User Guide). A standard mix (pooled standard mix or PSM) was prepared by pooling DNA from sk1, TP901-1, P220 and LN04 in equimolar concentrations. The PreAmp thermocycling conditions were as follows: hot start at 95°C for 5 min, 14 cycles of (i) 95°C for 15 sec, (ii) 55°C for 30 sec and (iii) 60°C for 1 min, followed by a holding stage (60°C for 10 min).
The HT-qPCR assay was performed on the BioMark HD System (Fluidigm) according to the suppliers’ protocol (Fluidigm PN 100–7717 B1) using the Flex Six IFC (Fluidigm) chip and the following thermal conditions: thermal mix (1 cycle at 25°C for 360 sec, 1 cycle at 70°C for 360 sec), hot start (1 cycle 95°C for 300 sec), cycling (40 cycles of (i) 95°C for 15 sec, (ii) 55°C for 30 sec, and (iii) 60°C for 30 sec). Melting curve was applied using default settings.
The HT-qPCR assay was performed on the BioMark HD System (Fluidigm) according to the suppliers’ protocol (Fluidigm PN 100–7717 B1) using the Flex Six IFC (Fluidigm) chip and the following thermal conditions: thermal mix (1 cycle at 25°C for 360 sec, 1 cycle at 70°C for 360 sec), hot start (1 cycle 95°C for 300 sec), cycling (40 cycles of (i) 95°C for 15 sec, (ii) 55°C for 30 sec, and (iii) 60°C for 30 sec). Melting curve was applied using default settings.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!