Iscript cdna synthesis kit

Samples from the right and left atria, right and left ventricles and SNs were carefully dissected. Quantitative PCR was performed using QuantStudio 5 (Applied Biosystems, Thermo Fisher Scientific, Massachusetts, USA). Total mRNA was extracted from heart tissue using TriPure Isolation Reagent (Roche, Paris, France), and 1 μg of RNA was used for the reverse transcription reaction (iScript cDNA Synthesis kit. Bio-Rad, CA, USA). The reactions were carried out in a final volume of 5 μl containing 300 nM primers and 1 μl of cDNA using a SYBR Premix Ex Taq (Tli RNaseH Plus) kit (Takara BioInc., Göteborg, Sweden). The samples were subjected to the following conditions: 30 s at 95 °C, 40 cycles (10 s at 95 °C, 30 s at 60 °C), and a melting curve at 60–95 °C with a slope of 0.1 °C/s. The reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control for quantification (KiCqStart Primers, Merck, Darmstadt, Germany). The resulting values are expressed as the relative levels with respect to the control levels (2^−ΔΔCT). Human liver tissue (“Biobanco Región de Murcia”, national register number B.0000859) was used as a positive control for glucagon receptor gene expression.
Specific primers for gene level analysis, as well as accession numbers and amplicon lengths, are shown (Additional file 2: Table S2).

Total RNA was extracted using TRIzol reagent (Takara). To determine mRNA and circRNA expression, the iSCRIPT cDNA Synthesis Kit (Roche Life Science) was utilized to synthesize complementary DNA (cDNA) from mRNA and circRNA, while the miRNA First Strand cDNA Synthesis Kit (Sangon) was to synthesize that from miRNA. Amplification was performed on a CFX96 Touch real-time PCR instrument (Bio-Rad Laboratories) using TB Green Fast qPCR Mix (Takara). Results were analyzed using the 2^-ΔΔCt method. The primer sequences are shown in Table 1.

Isolated lung was homogenized in 2ml Trizol reagent (Invitrogen) and RNA was isolated by Trizol-Choloform method. Yield of RNA was quantitated by nano-drop and 1 µg of RNA was use to reverse-transcribed to cDNA using the iScript cDNA synthesis kit (BIORAD; #1708891) (Roche). 1:5 diluted cDNAs was used for qPCR by using KAPA SYBR^® FAST qPCR Master Mix (5X) Universal Kit (KK4600) on Fast 7500 Dx real-time PCR system (Applied Biosystems) and the results were analyzed with SDS2.1 software (30 (link), 33 (link)). Briefly, 200 ng of RNA was used as a template for reverse transcription-polymerase chain reaction (RT-PCR). The CDC-approved commercial kit was used for of SARS-CoV-2 N gene: 5′-GACCCCAAAATCAGCGAAAT-3′ (Forward), 5′-TCTGGTTACTGCCAGTTGAATCTG-3′ (Reverse). Hypoxanthine-guanine phosphoribosyl transferase (HGPRT) gene was used as an endogenous control for normalization through quantitative RT-PCR. The relative expression of each gene was expressed as fold change and was calculated by subtracting the cycling threshold (Ct) value of hypoxanthine-guanine phosphoribosyl transferase (HGPRT-endogenous control gene) from the Ct value of the target gene (ΔCT). Fold change was then calculated according to the formula POWER(2,-ΔCT)*10,000 (36 (link), 37 (link)).

Total RNA was extracted from PC cells and tissues using TRIzol reagent (Takara). To determine mRNA and circRNA expression, cDNA was reverse transcribed using the iSCRIPT cDNA synthesis Kit (Roche® Life Science), while the miRNA First Strand cDNA Synthesis Kit (Sangon) was used to reverse transcribe miRNA as cDNA. Amplification was performed on a CFX96 Touch Real-Time Fluorescence Quantitative PCR Instrument (Bio-Rad Laboratories) using TB Green® Fast qPCR Mix (Takara). GAPDH (mRNA and circRNA) and U6 (miRNA) were used as loading controls. The results were analyzed using the 2 ^-ΔΔCt method. The primer sequences used in the present study were as follows:
circATG7 Forward primer (5′ to 3′): CTCCTCTTGACATTTGCAGAGTG,
circATG7 Reverse primer (5′ to 3′): GCAGTCTTGAAAGACTCGAGTGTG;
miR-766-5p Forward primer (5′ to 3′): TCGAGTACTTGAGATGGAGTTTT,
miR-766-5p Reverse primer (5′ to 3′): GGCCGCGTTGCAGTGAGCCGAG;
ATG7 Forward primer (5′ to 3′): CAGTTTGCCCCTTTTAGTAGTGC,
ATG7 Reverse primer (5′ to 3′): CCAGCCGATACTCGTTCAGC;
U6 Forward primer (5′ to 3′): CTCGCTTCGGCAGCACA,
U6 Reverse primer (5′ to 3′): AACGCTTCACGAATTTGCGT;
GAPDH Forward primer (5′ to 3′): CTCCAAAATCAAGTGGGGCG,
GAPDH Reverse primer (5′ to 3′): TGGTTCACACCCATGACGAA.