Mice were genotyped using the REDExtract‐N‐Amp Tissue PCR kit from Sigma‐Aldrich (Dorset, UK), as described by the manufacturer. Briefly, DNA was extracted from ear snip tissue (2–3 mm) by incubating it with Extraction Solution and Tissue Preparation Solution in a 4:1 ratio for 10 min at room temperature. The mixture was then transferred into a heating block and incubated at 95°C for 3 min, before digestion was stopped by adding the Neutralization solution. The extracted DNA was mixed with PCR ReadyMiX (Sigma‐Aldrich) and the PKG[C42S]KI‐specific primers, 5′‐cag ttt agg gac aga gtt gg‐3′ (forward) and 5′‐aac ctg ctt cat gcg caa gg‐3 (reverse), used at a final concentration of 0.4 μmol/L.
Pcr readymix
Manufactured by Merck Group
Sourced in India, Italy
PCR ReadyMix is a premixed solution containing all the essential components required for performing polymerase chain reaction (PCR) amplification of DNA samples. It includes DNA polymerase, buffer, dNTPs, and necessary cofactors, ready to use for PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Redextract n amp tissue pcr kit, by Merck Group (1 mentions)
Nuclease free water, by HiMedia (1 mentions)
Extraction solution, by Merck Group (1 mentions)
Dilution buffer, by Merck Group (1 mentions)
Macconkey agar, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
4 protocols using pcr readymix
1
Genotyping Mice Using REDExtract-N-Amp
2
DNA Extraction from Klebsiella pneumoniae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For DNA extraction, 62 of the randomly selected isolates exhibiting ESBL production in the initial screening test were made use of as per the procedure given by Bora et al.[15 (link)] Procedure was slightly modified to get the largest amount of DNA.
Five to six colonies of K. pneumoniae suspended in 200 μl double-distilled water and heated at 95°C for 10 min and added with equal proportion of 90% ethanol to DNA to get precipitated. The precipitated top solution was again added with equal proportion of 90% ethanol and centrifuged at 6440 × g for 5 min. Discarded the supernatant and to the deposit again added equal proportion of 90% ethanol and repeated the procedure for two more times. At the end of the procedure, the deposit was left to dry and added double distilled water to remove ethanol and again centrifuged at 6440 × g for 5 min. The deposit with few drops of nuclease-free water was directly used as template DNA for PCR study. The primers used and PCR cycling conditions were described in [Tables1 and 2 ].
The total concentration of PCR reaction to do single test was 25 μl [PCR ready mix-12.5 μl (Sigma Aldrich, Merck's Life Science), Forward primer-1 μl, Reverse primer-1 μl (Bioserve Hyderabad, India), Template DNA-4 μl and Nuclease free water-6.5 μl (Hi Media Laboratories Pvt, Ltd., Mumbai, India)].
Five to six colonies of K. pneumoniae suspended in 200 μl double-distilled water and heated at 95°C for 10 min and added with equal proportion of 90% ethanol to DNA to get precipitated. The precipitated top solution was again added with equal proportion of 90% ethanol and centrifuged at 6440 × g for 5 min. Discarded the supernatant and to the deposit again added equal proportion of 90% ethanol and repeated the procedure for two more times. At the end of the procedure, the deposit was left to dry and added double distilled water to remove ethanol and again centrifuged at 6440 × g for 5 min. The deposit with few drops of nuclease-free water was directly used as template DNA for PCR study. The primers used and PCR cycling conditions were described in [Tables
The total concentration of PCR reaction to do single test was 25 μl [PCR ready mix-12.5 μl (Sigma Aldrich, Merck's Life Science), Forward primer-1 μl, Reverse primer-1 μl (Bioserve Hyderabad, India), Template DNA-4 μl and Nuclease free water-6.5 μl (Hi Media Laboratories Pvt, Ltd., Mumbai, India)].
3
Rapid Ertapenem-resistant Bacterial Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Strains were grown on MacConkey agar (Oxoid), and in Brain Heart broth, both supplemented with ertapenem (0.125 mg/l). One colony was taken from the plate and 50 μl from the broth. Both were suspended in 100 μl Extraction Solution (SIGMA, E7526). Mixtures were incubated at 95°C for 10 minutes, cooled to room temperature, 100 μl Dilution Buffer (SIGMA, D5688) was added and mixed. PCR reactions were carried out using PCR-ReadyMix™ (SIGMA, E3004). Amplification was performed on ABI 7500 Real-Time PCR system (LifeTech, Glasgow, UK). The temperature profile included initial denaturation of 4 min. at 94°C, followed by 50 cycles (40 cycles, protocol 2) of 94°C for 15 sec., and 60°C for 1 min.
4
Genotypic Sex Determination by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genotypic sex of each animal was identified from the presence (male) or the absence (female) of SRY gene by PCR using PCR Ready Mix (Sigma, Milan, Italy).
As a control, a sequence of beta-actin gene (ACTB, Chr. 12p11) was also amplified. Therefore, PCR of SRY sequence yielded a 317 bp product in the male samples but not in the female ones. PCR of ACTB sequence yielded a 228 bp product in all the samples, confirming successful PCR. Female and male tissues were used as reference.
The following primers were used to amplify the SRY sequence: TACAGCCTGAGGACATATTA (forward), GCACTTTAACCCTTCGATGA (reverse). The following primers were used to amplify the ACTB sequence: AGCCATGTACGTAGCCATCC (forward), CTCTCAGC TGTGGTGGTGAA (reverse).
Fig. 1
As a control, a sequence of beta-actin gene (ACTB, Chr. 12p11) was also amplified. Therefore, PCR of SRY sequence yielded a 317 bp product in the male samples but not in the female ones. PCR of ACTB sequence yielded a 228 bp product in all the samples, confirming successful PCR. Female and male tissues were used as reference.
The following primers were used to amplify the SRY sequence: TACAGCCTGAGGACATATTA (forward), GCACTTTAACCCTTCGATGA (reverse). The following primers were used to amplify the ACTB sequence: AGCCATGTACGTAGCCATCC (forward), CTCTCAGC TGTGGTGGTGAA (reverse).
Fig. 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!