Src 1

Manufactured by Santa Cruz Biotechnology

SRC-1 is a laboratory equipment product offered by Santa Cruz Biotechnology. It is designed for general research purposes. The core function of SRC-1 is to facilitate standard laboratory procedures and tasks.

Automatically generated - may contain errors

Lab products found in correlation

Rna pol 2, by Santa Cruz Biotechnology (2 mentions) H3k4me2, by Abcam (2 mentions) Src 3 actr65, by Santa Cruz Biotechnology (2 mentions) H3k4me3, by Abcam (2 mentions) H3k27ac, by Abcam (2 mentions) Sbe4 luc, by Addgene (1 mentions) Sigenome smartpool sirna, by Horizon Discovery (1 mentions) Src 2, by BD (1 mentions) Flag tag (flag), by Merck Group (1 mentions) N cadherin, by Cell Signaling Technology (1 mentions) E cadherin, by Cell Signaling Technology (1 mentions) Vimentin, by Cell Signaling Technology (1 mentions) β actin, by Cell Signaling Technology (1 mentions)

4 protocols using src 1

Chromatin Immunoprecipitation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP-qPCR analysis was performed as described previously⁵¹. The antibodies used for ChIP assay are AR (Santa Cruz; sc-815); RNA Pol-II (Santa cruz; sc-899); H3K4me2 (Abcam ab32356); H3K4me3 (Abcam; ab8580); H3K27ac (Abcam; ab4729); H3 (Active Motif; #39163); p300 (Santa Cruz; sc-585); SRC-1 (Santa Cruz; sc-8995); SRC-3/ACTR⁶⁵, and IgG (Santa Cruz; sc-2027). Anti-RORγ rabbit serum was generated by Covance using purified GST-human RORγ fragment (amino acids 79–301) expressed in E.coli. PCR primers used in the ChIP assays were listed in the Supplementary table 2. ChIPs were performed with each experimental point in triplicate, and each experiment was repeated three times.

Wang J., Zou J.X., Xue X., Cai D., Zhang Y., Duan Z., Xiang Q., Yang J.C., Louie M.C., Borowsky A.D., Gao A.C., Evans C.P., Lam K.S., Xu J., Kung H.J., Evans R.M., Xu Y, & Chen H.W. (2016). ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer. Nature medicine, 22(5), 488-496.

+ Open protocol

+ Expand

ChIP-qPCR for RARB and HOXA1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sheared chromatin was prepared following the manufacturer’s instructions and was immunoprecipitated using RXRα (Santa Cruz Biotechnology), AHH3 and SRC-1 (Cell signaling) antibodies. The eluted DNA and inputs was subjected to PCR for RARB and HOXA1 genes. For RARB2 (Sense: 5’AGCTCTGTGAGAATCCTGGGAG3’, Antisense: 5’TAGACCCTCCT GCCTCTGAACA3’) and HOXA1 (Sense: 5’CTGGGG CAATCAGATTCAAACC3’, Antisense: 5’CTCAGATAAACTGCTGGGACTC3’) primers were used for PCR amplification using Taq PCRx polymerase kit (Invitrogen) following the manufacturer’s instructions. These PCRs were performed without enhancers and repeated at least three times.

Srivastava J., Robertson C.L., Rajasekaran D., Gredler R., Siddiq A., Emdad L., Mukhopadhyay N.D., Ghosh S., Hylemon P.B., Gil G., Shah K., Bhere D., Subler M.A., Windle J.J., Fisher P.B, & Sarkar D. (2014). AEG-1 regulates retinoid X receptor and inhibits retinoid signaling. Cancer research, 74(16), 4364-4377.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Investigating EMT Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies used include β-actin (Cell Signaling #4970), FLAG (Sigma #F1804), e-cadherin, snail, slug, vimentin, n-cadherin (Cell Signaling, EMT Ab sampler kit #9782S), SRC-1 (Santa Cruz Biotechnology #sc-32789), SRC-2 (BD Biosciences #610985) and SRC-3 (in-house monoclonal antibody created by the BCM Monoclonal Antibody Core). HRP conjugated donkey anti-rabbit and sheep anti-mouse secondary antibodies were from Pierce. pCMV-FLAG-SRC-3 has been previously described (28 (link)). SBE4–luc, FLAG-Smad3 full length, FLAG-Smad3-NL, and FLAG-Smad3-C plasmids were obtained from Addgene. The siGENOME SMARTpool siRNAs targeting SRC-1 (M-005196-03-0005), SRC-2 (M-020159-01-0005) or SRC-3 (M-003759-02-0010) and a non-targeting siRNA (pool #2, D-001206-14-05 or siRNA #3, D-001210-03-05) were purchased from Dharmacon. SI-2 was synthesized in our laboratory at BCM.

Rohira A.D., Yan F., Wang L., Wang J., Zhou S., Lu A., Yu Y., Xu J., Lonard D.M, & O’Malley B.W. (2017). Targeting SRC coactivators blocks the tumor-initiating capacity of cancer stem-like cells. Cancer research, 77(16), 4293-4304.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!