Cfx96 real time machine

U266 and MM1.S cells were treated with solvent control (DMSO) or MO-OH-Nap for 24 or 48 hours. RNA was isolated using Qiashredder and RNAeasy Plus kits (Qiagen). cDNA was synthesized from 1mg of total RNA using the iScript cDNA synthesis kit (Bio-Rad). iTaq Universal SYBR Green Supermix (Bio-Rad) was mixed with cDNA and gene specific primers at a final volume of 10 μL. qRT-PCR was performed using a CFX96 real time machine (Bio-Rad). All reactions were performed in duplicate and data was normalized to the expression of β-actin. Primer sequences can be found in Supplementary Table 4.

Total RNA was extracted from ovaries of 1- to 2-day-old females, using TRI reagent (Sigma). Samples were then treated with Turbo DNase (Ambion) and the RNA was precipitated using acid phenol: chloroform (Ambion). cDNA was synthesized from 2 µg RNA using Maxima H Minus First Strand cDNA synthesis kit (Thermo Scientific). Random hexamers were used for reverse transcription, and to enrich rp49 cDNA a specific RT primer (5′-TTGGAGGAGACGCCG-3′) was added to the mixture. The resulting cDNA was used for RT-qPCR using HeT-A-1, 18S rRNA and pre-rp49 primers described by (Zhang et al., 2012 (link)). RT-qPCR was performed in a CFX96 Real-Time machine (Bio-Rad) using DyNAmo Flash SYBR Green (ThermoScientific). The expression level of HeT-A was quantified relative to 18S rRNA and pre-rp49. A minimum of three biological replicates were tested for each genotype. The graph shows the average and the error bars indicate the standard error of the mean (SEM).

2 × 10⁶ K562 cells were incubated with N-terminally biotinylated peptides (c(peptide) = 10 μM, t = 2.5 h) for uptake on a rotating wheel at 37°C. The cells were extensively washed in PBS and lysed in lysis buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 0.05% IGEPAL CA-630, 1 mM EDTA) supplemented with 0.5 U/μl RNAse inhibitor (Superase-in, ThermoFisher). The lysate was cleared by centrifugation at 21 000 g at 4°C, an aliquot of the supernatant was removed and re-suspended in Trizol, while the remaining was incubated with streptavidin-coupled magnetic beads (Dynabeads M280, ThermoFisher) on a rotating wheel (2 h, 4°C). After magnetic separation and washing (3× in lysis buffer), the beads were re-suspended in 20 μl lysis buffer, re-suspended in Trizol (ThermoFisher), and 400 ng t-RNA was added per sample as a carrier. RNA was extracted from Trizol using the standard protocol and the qRT-PCR was performed according to a previously published protocol (62 (link)) using the primers h-miR21-3p-FW (CAGCAACACCAGTCGATG), h-miR21-3p-RV (GGTCCAGTTTTTTTTTTTTTTTACAG), h-miR21-5p-FW (GCAGTAGCTTATCAGACTGATG), h-miR21-5p-RV (GGTCCAGTTTTTTTTTTTTTTTCAAC) in a CFX96 real-time machine (Bio-Rad). The relative enrichment was calculated as a ratio of copies in the immunoprecipitate over input normalized to the enrichment of the control peptide D1.