Whole genome, shotgun sequencing was performed on an Illumina HiSeq 1500 at the Marshall University Genomics Core Facility. One paired-end library and eight mate pair libraries were prepared from purified genomic DNA and sequenced. We prepared the paired end library using Illumina TruSeq® DNA PCR-Free LT Library Preparation Kit from genomic DNA according to the manufacturer’s instructions; average insert size for this library was 462 base pairs (bp). These libraries were sequenced in three separate 2 × 250 bp paired-end HiSeq1500 Rapid Runs. Gel-free and gel-plus mate pair libraries were prepared using the Nextera Mate Pair Library Prep Kit according to the manufacturer’s instructions. Gel-plus libraries were prepared from DNA fragments in three size ranges: 4-6kb, 6-9kb and 9-12kb. Adaptor enrichment (library amplification) was 10 cycles of PCR for gel-free libraries and 15 cycles of PCR for gel-plus libraries. Two replicates were generated for each gel-free and gel-plus mate pair library, resulting in 8 libraries in total. Average library insert sizes for gel-free and gel-plus libraries ranged from 345 to 515 bp and from 240 to 363 bp, respectively. Mate pair libraries were sequenced in a 2 × 150 bp paired-end Rapid Run mode. Illumina HiSeq sequencing used the HiSeq PE Rapid Cluster Kit v2 and HiSeq Rapid SBS Kit v2 sequencing kits.
Truseq dna pcr free lt library preparation kit
Manufactured by Illumina
Sourced in United States
The TruSeq DNA PCR-free LT Library Preparation Kit is a lab equipment product designed for the preparation of DNA libraries for sequencing purposes. It allows for the construction of libraries without the need for PCR amplification, which can introduce biases. The kit provides a streamlined workflow for preparing library samples from DNA input.
Automatically generated - may contain errors
Lab products found in correlation
Miseq reagent kit v3, by Illumina (3 mentions)
Gelred, by Biotium (2 mentions)
Miseq platform, by Illumina (2 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (2 mentions)
Ampure xp bead, by Beckman Coulter (2 mentions)
Qubit broad range ds dna reagents, by Thermo Fisher Scientific (2 mentions)
Hiseq rapid pe cluster kit v2, by Illumina (1 mentions)
Hiseq 1500, by Illumina (1 mentions)
Hiseq rapid sbs kit v2, by Illumina (1 mentions)
Agilent 2100 bioanalyser, by Agilent Technologies (1 mentions)
2100 bioanalyser, by Agilent Technologies (1 mentions)
Miseq system, by Illumina (1 mentions)
Clc genomics workbench version 11, by Qiagen (1 mentions)
M220 ultrasonicator, by Covaris (1 mentions)
Bcl2fastq conversion software, by Illumina (1 mentions)
Miseq v2 sequencing kit, by Illumina (1 mentions)
Agilent bioanalyzer, by Agilent Technologies (1 mentions)
Qubit fluorometer, by Agilent Technologies (1 mentions)
Nextseq 500, by Illumina (1 mentions)
8 protocols using truseq dna pcr free lt library preparation kit
1
Whole Genome Shotgun Sequencing on Illumina HiSeq 1500
2
16S rRNA Amplicon Sequencing of Fecal DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using ZP Faecal DNA MiniPrep Kit (Zymo Research) and then purified with AMPure XP Beads (Beckman Coulter) according to the manufacturer’s guide. The 16S rRNA gene was amplified using barcoded 341 and 805 F primers (18 (link)) targeting the V3 and V4 regions of the gene. PCRs were performed in 50 µl volume using 1 U Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific), 0.20 µM primers, 200 µM dNTP mix, and 2.5 mM MgCl2. The thermal program was the following: denaturation at 98°C for 30 s, 30 cycles of 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, and final elongation at 72°C for 5 min. To verify the amplicon size, 5 µl of the PCR mixes were loaded on a 1.5% agarose gel stained with GelRed (Biotium). Amplicons were then purified with AMPure XP Beads (Beckman Coulter) according to the manufacturer’s protocol. Concentrations were estimated using Qubit Broad Range ds DNA reagents (Invitrogen). Barcoded samples were pooled in equimolar amounts, followed by adapter ligation using TruSeq DNA PCR-free LT Library Preparation Kit (Illumina). Agilent 2100 BioAnalyser was used for final check of the prepared libraries. 16S rRNA sequencing was performed in Illumina Miseq platform after spiking the denatured pools with PhiX DNA (10%) with MiSeq V3 reagent kit.
3
16S rRNA Gene Sequencing of Bacterial DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA was extracted from the MP beads, sequenced, and processed as described previously (Ogonowski et al., 2018 (link)). Briefly, PCR amplicon libraries of the 16S rRNA encoding gene were produced using a barcoded primer set adapted for the Illumina MiSeq, TruSeq DNA PCR-free LT Library Preparation Kit (Illumina) and targeting the V3 and V4 regions of the gene. Quality control was performed on an Agilent 2100 BioAnalyser using high sensitivity DNA chip. PhiX DNA (10%) was added to the denatured pools and sequencing was performed on an Illumina MiSeq (600-cycles). DNA sequence data were generated using paired-end sequencing, demultiplexed, and subjected to quality filtering, dereplication, sorting, OTU clustering and mapping according to the UPARSE pipeline guidelines on the UPPMAX cluster (https://wiki.bils.se/wiki/Running_the_Uparse_pipeline_at_the_UPPMAX_cluster ). Taxonomic identification was performed using SINA to annotate OTU clusters against the SSU NR99 SILVA database. The sequenced data were deposited through NBCI SRA project PRJNA382770 and used here.
4
ZIKV Genome Sequencing Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR products that were generated with each primer set (1 kb set and 2 kb set) were processed separately to enable primer output to be assessed. The 12 kb amplicons were sonicated using an M220 ultrasonicator (Covaris, Woburn, MA, USA) and final sheared sizes ranged from 144 to 186 bp with an average size of 164 bp. Libraries were prepared using the TruSeq DNA PCR-Free LT Library Preparation Kit (Illumina, San Diego, CA, USA) following standard manufacturer’s protocols with the exception of the bead-based library size selection steps in which 150 bp sized libraries were selected instead of the standard kit sizes. Indexed samples were pooled and sequenced on the Illumina MiSeq system with the MiSeq V2 sequencing kit utilizing 2 X 150 bp paired-end reads. Sequences were de-multiplexed and trimmed using the Illumina bcl2fastq conversion software. Error rate due to PCR and sequencing was controlled for using a plasmid control of known sequence and overlapping read pair analysis as described previously [40 (link)].
Illumina MiSeq sequences were imported as fastq files into CLC Genomics Workbench version 11 (Qiagen). Reads were mapped to the reference sequence of the ZIKV strained used for infection. Only nucleotide positions be covered by > 100 reads, with a base quality score >Q30 were used for variant calls.
Illumina MiSeq sequences were imported as fastq files into CLC Genomics Workbench version 11 (Qiagen). Reads were mapped to the reference sequence of the ZIKV strained used for infection. Only nucleotide positions be covered by > 100 reads, with a base quality score >Q30 were used for variant calls.
5
Genome Sequencing of Artemisia tridentata
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A diploid (2n = 2x = 18) individual of Artemisia tridentata Nutt. subsp. tridentata from a common garden in Orchard, Idaho (USA), grown from seed collected near Mountain Home, Idaho, USA (43.3371, −116.0081), was sampled for DNA extraction and genome sequencing (1C = 2.98 Gbp; Richardson et al., 2012 (link); other individuals of this species have been found to have much larger genome sizes: 1C = 4.12–4.21 Gbp; Garcia et al., 2008 (link)). This individual, known as IDT2‐2, was grown as part of a long‐term experiment conducted by the USDA Forest Service in the Orchard common garden (Richardson & Chaney, 2018 (link)). DNA extraction was performed at Boise State University using a Qiagen Plant Mini kit per manufacturer protocol and quantified using Qubit (Thermo Fisher Scientific, Waltham, MA USA). A sample of 30 ng/μl was sent to the HudsonAlpha Institute for Biotechnology (Huntsville, AL, USA) for sequencing. A PCR‐free 2 ×150 bp paired‐end library of 350 bp standard was constructed using the Illumina TruSeq DNA PCR‐Free LT Library Preparation Kit (cat #20015962). After construction, the library was assessed for concentration by a Qubit™ fluorometer, fragment size with an Agilent Bioanalyzer, and optimal loading concentration by qPCR.
6
ITS Region Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ITS5 (forward, GGAAGTAAAAGTCGTAACAAGG) and ITS4 (reverse, TCCTCCGCTTATTGATATGC) primers were used to amplify the internal transcribed region including the 5.8 ribosomal gene (19 (link)). PCR reactions were performed in 50 µl volume using 1 U Phusion high-fidelity DNA polymerase (Thermo Fisher Scientific), 0.20 µM primers, 200 µM dNTP mix, and 2.5 mM MgCl2. The thermal program was the following: denaturation at 98°C for 30 s, 30 cycles of 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, and final elongation at 72°C for 5 min. To verify the amplicon size, 5 µl of the PCR mixes were loaded on a 1.5% agarose gel stained with GelRed (Biotium). PCR products were purified using AMPure XP Beads (Beckman Coulter) according to the manufacturer’s protocol. Concentrations were estimated using Qubit Broad Range ds DNA reagents (Invitrogen). Due to low-DNA concentrations, 10 samples were excluded from further procedures. Eight samples were pooled in equimolar amounts and preceded for adapter ligation using TruSeq DNA PCR-free LT Library Preparation Kit (Illumina). PCR product from C. albicans strain was proceeded separately and used as positive control in sequencing. Sequencing was performed in Illumina Miseq platform after spiking the denatured pools with PhiX DNA (5%) with MiSeq V3 reagent kit.
7
Lung Tissue DNA Sequencing Library Prep
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from Esperanza's lung tisse (used also for long-read sequencing, above) was converted into sequencing libraries using the TruSeq DNA PCR-Free LT Library Preparation Kit (Illumina Inc., San Diego, CA) as directed. The shearing was conducted on a Covaris S220 instrument (Covaris Inc., Woburn, MA) with setting to 350-bp fragment size. The same procedure was used to create libraries for parental and unrelated yak samples, except the DNA was prepared from blood using a standard phenol: chloroform extraction as described previously [29 (link)]. Sequencing was performed by 2 × 150 bp paired-end sequencing on a NextSeq500 instrument (Illumina NextSeq 500, RRID:SCR_014983 ) using High Output Kit v2 (300 cycles) kits.
8
Genomic DNA Sequencing by Illumina MiSeq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was sheared by nebulization according to Roche (Rapid Library Preparation Manual GS FLX+/XL+ version: May 2011). DNA library 466 KIS ET AL.
was prepared using the TruSeq DNA PCR-Free LT Library Preparation Kit (Illumina Inc., San Diego, CA, USA) following the instructions of the manufacturer. Paired-end sequencing was carried out on Illumina MiSeq bench top sequencing platform with MiSeq reagent kit v3 (2 × 300 cycles).
was prepared using the TruSeq DNA PCR-Free LT Library Preparation Kit (Illumina Inc., San Diego, CA, USA) following the instructions of the manufacturer. Paired-end sequencing was carried out on Illumina MiSeq bench top sequencing platform with MiSeq reagent kit v3 (2 × 300 cycles).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!