EGFR‐pCMV6 plasmid was purchased from OriGene. GST‐tagged ERRFI1 full‐length and deletion mutant constructs were gifts from Dr. Rüdiger Klein, Max Planck Institute of Neurobiology. In brief, PCR‐amplified ERRFI1 full‐length and deletion mutants were recombined into pDONOR201 vector. The pDONOR201 vectors containing ERRFI1 full‐length or deletion mutants were shuttled into pDEST 27 NH2‐terminal‐GST for mammalian expression 56 . Full‐length ERRFI1 was cloned into pET28a vector (Clontech), and AKT was cloned into the pGEX4T‐1 vector (Amersham Biosciences) for bacterial expression. These plasmids were expressed in BL21 cells, and proteins were purified with His magnetic agarose Beads (Sigma, St. Louis, MO) and glutathione beads (Amersham Biosciences) according to the manufacturer's instruction.
Pet28a vector
Manufactured by Takara Bio
Sourced in China, Japan, United States
The PET28a vector is a plasmid used for protein expression in Escherichia coli (E. coli) cells. It contains a T7 promoter, lacI repressor gene, and a kanamycin resistance marker. The vector allows for the expression of recombinant proteins with an N-terminal His-tag for purification purposes.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Takara Bio (2 mentions)
Glutathione bead, by Cytiva (1 mentions)
Pgex 4t 1 vector, by Cytiva (1 mentions)
Sf 900 2 sfm media, by Thermo Fisher Scientific (1 mentions)
Ni sepharose high performance affinity media, by GE Healthcare (1 mentions)
Gelred, by Biotium (1 mentions)
Superdex 75 column, by GE Healthcare (1 mentions)
Site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Bl21 de3, by Takara Bio (1 mentions)
E coli bl21 de3 cells, by New England Biolabs (1 mentions)
Idt codon optimization tool, by Integrated DNA Technologies (1 mentions)
Pet28a vector, by New England Biolabs (1 mentions)
Gblock, by Takara Bio (1 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
Gblock, by Integrated DNA Technologies (1 mentions)
Pmd19 vector, by Takara Bio (1 mentions)
Ag1478, by Selleck Chemicals (1 mentions)
Beta actin mouse mab, by Proteintech (1 mentions)
Recombinant hegf, by Merck Group (1 mentions)
Bamhi restriction enzyme, by Takara Bio (1 mentions)
12 protocols using pet28a vector
1
ERRFI1 Cloning and Purification
2
Drosophila S2 Cell RNAi Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Drosophila S2 cell culture, in vitro dsRNA synthesis, and RNAi treatments were performed as previously described (Rogers and Rogers, 2008 (link)). Cells were cultured in Sf900II SFM media (Life Technologies). RNAi was performed in 6-well plates. For IP assays, cells (40–90% confluence) were treated with 10 µg dsRNA in 1 ml of medium and replenished with fresh medium/dsRNA every day for 7 d. For immunofluorescence microscopy, cells were transfected with 40 µg dsRNA on days 0, 4, and 8. An ∼550-bp control dsRNA was synthesized from DNA template amplified from a noncoding sequence of the pET28a vector (Clontech) using the primers 5′-ATCAGGCGCTCTTCCGC-3′ and 5′-GTTCGTGCACACAGCCC-3′. (All primers used for dsRNA synthesis begin with the T7 promoter sequence 5′-TAATACGACTCACTATAGGG-3′, followed by template-specific sequence). dsRNA targeting the Ana2 UTR was synthesized from EST LD22033 template by first deleting the Ana2 cDNA, and then joining 91 bp of 5′ UTR with 78 bp of 3′ UTR to create the following sequence: 5′-AGTTCCACCCCTAAGTCGATCGACTTCCAATTGGACAGATTCTCCCGCTCGAATTTAATTTAATCGGCAAATATAAACAAATACGCTCCAAAAGCATGTACAATGTTCGTTTTGTTATTTATGCATATGTCTATTTGCGATTTAAGTGGAAATATATTTCAATACACGG-3′. This template was amplified using the primers 5′-CAGATTCTCCCGCTCG-3′ and 5′-TTCCGTGTATTGAAATATATTTCC-3′. Immunoblotting confirmed that Ana2 UTR RNAi depleted endogenous Ana2 by ∼80–90% (Fig. S1 C).
3
Purification of Recombinant Rat HMGB1 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant rat histidine-tagged HMGB1 cDNA was cloned into pET28a vector (Clontech, Mountain View, CA, USA) as previously published [38 (link)] and transformed into BL21 (DE3) strain (Stratagene, Santa Clara, CA, USA). The protein, with 99 % homology to human HMGB1, was purified with Ni Sepharose High Performance affinity media (GE Healthcare, Chalfont St. Giles, UK) according to the protocol supplied by the manufacturer, followed by gel filtration on a Superdex 75 column (GE Healthcare) with phosphate-buffered saline (PBS), pH 7.4, as running buffer. Endotoxin was removed by addition of 1 % Triton X-114 and incubation at 4 °C for 30 minutes, followed by incubation in a 37 °C water bath for 10 minutes, and subsequently centrifugation at 18,300 g/25 °C for 10 minutes. This procedure was repeated once and yielded endotoxin levels below 0.003 EU/μg protein, according to the Limulus amoebocyte lysate assay (analyzed by the clinical laboratory at Karolinska University Hospital, Stockholm, Sweden). The protein preparation was also free from DNA as evaluated by agarose gel electrophoresis and staining for DNA with GelRed (Biotium, Hayward, CA, USA).
4
Molecular cloning and mutagenesis of RALY and FMDV proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of BHK-21 cells was extracted and used as the template for amplifying the cDNA of RALY. The cDNA fragments of the pCMV-N-Flag vector and RALY were digested by EcoRI and XhoI endonuclease, respectively, and the cDNA fragments of RALY were inserted into pCMV-N-FLAG skeleton vector to obtain FLAG-RALY recombinant plasmids, respectively. The pET28a vector (Clontech, USA) and RALY cDNA were synthesized by Sangon Biotech (Shanghai). The cDNAs of FMDV non-structural proteins Lpro, 2B, 2C, 3A, 3B, 3Cpro, and 3Dpol were cloned from the genome of FMDV strain O/BY/CHA/2010 and then inserted into the pCMV-N-Flag vector. Several residues of Flag-3Cpro were mutated with a site-directed mutagenesis kit (Agilent Technologies, CA, USA) to generate Flag-3Cpro mutants H46Y, H84N, C163G, and H205R. psiCHECK-FMDV was constructed as previously described (4 (link)). All the recombinant plasmids were verified with DNA sequencing.
5
Expression and Purification of MUC1-CD Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Vectors expressing GST-MUC1-CD, GST-MUC1-CD(AQA) and His-MUC1-CD, GFP-MUC1-CD and FLAG-MUC1-CD have been described [7 (link)]. His-tagged MUC1-CD (rat and dog) were cloned in pET28a vector (Clontech, Mountain View, CA) and expressed in E. coli BL21(DE3).
6
Endolysins Fusion Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, the E. coli strains DH5α and BL21 (DE3) (Takara, Dalian, China) were used for cloning and expressing the fusion endolysins, respectively. E. coli strains (ATCC25922, CVCC1418 and O78), Acinetobacter baumannii (A. baumannii) strain, and Streptococcus suis (S. suis) strain were stored in the lab. The restriction endonucleases NdeI and SalI, T4 DNA ligase, and pET-28a vector (Takara, Dalian, China) were used to construct the recombinant vectors. Genscript Ni–NTA affinity chromatography medium (GE Healthcare, Beijing, China) was used for purifying endolysins, and primers were synthesized by Jilin Ku Mei Biotechnology Co., Ltd.
7
Codon Optimization and Cloning of Bacterial Genes
8
Cloning and Antibiotic Susceptibility
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA fragments containing the floR and the cfr genes were amplified by PCR using the primers (Table 1 ). The complete ORF fragment of the PCR product was cloned into a pMD19 vector (TaKaRa, Dalian, China). The recombinant clones were picked and sequenced. The recombinant plasmid was digested with restriction endonucleases, and the ORF fragment was recovered and further cloned into a pET28a vector (TaKaRa, Dalian, China). Finally, the recombinant plasmids were transformed into the host strain BL21. The minimal inhibitory concentrations of antibiotics were determined by the agar dilution method for the recipient strains BL21, BL21[pET28a-floR], and BL21[pET28a-cfr] in accordance with the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2017).
9
Cloning and Characterization of Catabolic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids and primers used in this study were listed in Table 1 . The mhpB2, hpaB and hpaC genes were amplified from S. acidophilus TPY genomic DNA, purified and digested with restriction enzymes, and ligated to pET-32a(+) or pET-28a(+) vector (Takara, Dalian, China) digested with the same restriction enzymes, respectively. The generated recombinant plasmids were named pET-32a(+)-hpaB, pET-32a(+)-hpaC and pET-28a(+)-mhpB2, and transformed into E. coli DH5α respectively. Positive colonies were selected on LB plates containing ampicillin or kanamycin, and confirmed by sequencing of the harbored plasmids. The recombinant plasmids were then transformed into E. coli BL21(DE3). The enzyme activity of positive transformants containing mhpB2 gene was detected by spraying catechol (0.1 M) or 3,4-DHPA (0.025 M) solution on the cells grown on LB plates. Colonies of positive transformants overexpressing DHPAO would turn yellow on the plates, for the formation of yellow-colored product from colorless catechol [22 (link)] or 3,4-DHPA [3 (link)].
10
Recombinant EGFR and NcMIC3 Protein Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific EGFR and phospho-EGFR (Tyr1068) rabbit monoclonal antibodies (mAb) were from Cell Signaling Technology, Inc. (Beverly, MA, United States). AG1478 were from Selleck Chemical., Co. (Houston, TX, United States). Beta-actin mouse mAb was from Proteintech (West Grove, PA, United States). Cy3- or FITC-conjugated goat anti-rabbit or anti-mouse IgG, peroxidase-conjugated goat anti-rabbit and goat anti-mouse IgG were all from Proteintech. Recombinant hEGF was from Sigma Chemical., Co. (St. Louis, MO, United States). Prokaryotic recombinant protein NcMIC3 (rNcMIC3) and mouse antiserum specific for NcSAG1 was produced in our Laboratory. Full-length gene of N. caninum MIC3 was subcloned into the pET-28a (+) vector (TaKaRa, Japan) containing the His-tag, and the recombination pET-28a-NcMIC3 contains four EGF sequence repeats.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!