Human nucleus pulposus cells were purchased from ScienCell. Cells were incubated in human NP cell medium (ScienCell) with fetal bovine serum and antibiotics. When the confluence reached about 70%-90%, the cells were trypsinized, counted, and passaged. Cells from passages 4 to 7 were cultured in 6-well plates with about 8 ml medium. When they adhered, the medium was changed and the following treatments were performed.
Human np cell medium
Manufactured by ScienCell
Sourced in United States
Human NP cell medium is a specialized cell culture medium formulated to support the growth and maintenance of human neural progenitor (NP) cells. The medium provides essential nutrients and growth factors required for the optimal proliferation and differentiation of NP cells in vitro.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using human np cell medium
1
Isolation and Culture of Human NP Cells
2
Modulation of NP Cell Function
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells were purchased from ScienCell, Carlsbad, CA, and cultured in human NP cell medium (ScienCell) at 37 °C in 5% CO2 as previously described [20 ]. Lentivirus-mediated stably overexpressed or knockdown of KLF10 in NP cells were constructed according to the manufacturer's instructions (GenePharma, Shanghai, China). The target sequences of KLF10-shRNAs were as follows: KLF10 shRNA1 GCAAGAAAGAACATACCATGT, KLF10 shRNA2 GGAGTGACCATTTGACCAAGC. The efficiency of overexpressed and knocked down cells was certified by qRT-PCR and immunoblotting. After transfection, NP cells were treated with or without 10 ng/ml of interleukin-1β (IL-1β, Sigma) and 300 nmol/L of LY364947(a TGF-β Receptor I Kinase Inhibitor, APExBIO) in the culture medium for 12 h.
3
Human NP Cell Culture and Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells were obtained from ScienCell (Carlsbad, CA, USA) and cultured in Human NP Cell medium (ScienCell) at 37°C/5% CO2. The medium was changed every 3 days. When the cells reached 80–90% confluence, they were trypsinized, counted, and plated again at a density of 1.5×106 cells/ml. A total of 12 h after plating, cells were treated with or without 10 ng/ml IL-1β, 100 µg/ml purified collagen type II, and/or vehicle (0.05 M acetic acid, as used for collagen type II dissolution) for 48 h and then used in subsequent experiments.
4
Human NP Cell Culture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells were obtained from ScienCell (Carlsbad, CA, USA). Cells were cultured at 37˚C/5% CO2 by using human NP cell medium (ScienCell) and the cell medium was changed every 3 days. Cell trypsinization, counting and passaging were performed when NP cells reached 80%-90% confluence. Cells from passages 3-6 were cultured in 6-well plate at a density of 1.5 × 106 cells/ml. At 12h after plating, cells were given the indicated treatment for subsequent experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!