At baseline and week 18, blood samples (5 ml) were collected of all students who participated in the study, transferred to EDTA tubes and stored at −80°C. Total RNA from peripheral blood mononuclear cells (PBMCs) was subsequently isolated using the GeneAll RNA extraction kit (GeneAll, South Korea), cDNA synthesis was performed using the GeneAll cDNA synthesis kit (GeneAll, South Korea), and mRNA expression levels were determined using the Opticon real-time PCR detection system (Bio-Rad Laboratories, California). Reactions were carried out in duplicate using SYBR Green Gene Expression Master Mix (Cat. no. 638317; Takara, Japan). The HPRT gene was used as the reference gene for normalization, chosen because of its stable expression in blood cells. Quantification of transcripts of interest relative to the internal housekeeping control gene HPRT was performed using the 2−ΔΔCt method and expressed as fold change. Changing FTO and IRX3 expression was evaluated using the REST (Relative Expression Software Tool) software. Data on changes of gene expression were transferred to SPSS software in order to analyse their relationships with dietary intake and FTO genotype.
Cdna synthesis kit
Manufactured by GeneAll
Sourced in Cameroon
The cDNA Synthesis Kit is a laboratory product designed to convert RNA into complementary DNA (cDNA) molecules. The kit provides the necessary reagents and protocols to perform this reverse transcription process, which is a fundamental step in various molecular biology and genomic analysis techniques.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (10 mentions)
Rna extraction kit, by GeneAll (6 mentions)
Opticon real time pcr detection system, by Bio-Rad (4 mentions)
Realq plus 2x master mix, by Ampliqon (4 mentions)
Sybr green gene expression master mix, by Takara Bio (3 mentions)
Hybrid r blood rna purification kit, by GeneAll (3 mentions)
Step oneplus real time pcr, by Ampliqon (3 mentions)
Realq plus 2x master mix green, by Ampliqon (2 mentions)
Riboex total rna, by GeneAll (2 mentions)
Sensifast sybt no ros kit, by Meridian Bioscience (2 mentions)
Cfx connect system, by Bio-Rad (2 mentions)
Lb broth, by Merck Group (1 mentions)
Sybr green master mix, by Takara Bio (1 mentions)
Sybr premix ex taq 2 real time pcr kit, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Nanodrop one uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Allele id 7, by Premier Biosoft (1 mentions)
Hybrid rtm blood rna purification kit, by GeneAll (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
24 protocols using cdna synthesis kit
1
Evaluating FTO and IRX3 Gene Expression in Blood
2
Evaluating FTO and IRX3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At baseline and week 18, fasting blood samples (5 ml) were collected of all students who participated in the study, transferred to EDTA tubes and stored at − 80 °C. Total RNA from peripheral blood mononuclear cells (PBMCs) was subsequently isolated using the GeneAll RNA extraction kit (GeneAll, South Korea), cDNA synthesis was performed using the GeneAll cDNA synthesis kit (GeneAll, South Korea), and gene expression levels were determined using the Optic on real-time PCR detection system (Bio-Rad Laboratories, California). Reactions were carried out in duplicate using SYBR Green Gene Expression Master Mix (Cat. No. 638317; Takara, Japan). Melting curve and gel electrophoresis analysis of the amplification products was used to confirm that the primers amplified only a single product of expected size (data not shown).The HPRT gene was used as the reference gene for normalization, chosen because of its stable expression in blood cells. Quantification of transcripts of interest relative to the internal housekeeping control gene HPRT was performed using the 2−ΔΔCt method and expressed as fold change. Changing FTO and IRX3 expression was evaluated using the REST (Relative Expression Software Tool) software. Data on changes of gene expression were transferred to SPSS software in order to analyze relationships with FTO genotype.
3
Quantifying MDM2 Expression in HCT-116 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from HCT-116 cells (untreated and treated with apatinib and piperine at different concentrations as mentioned above) using an RNA extraction kit based on the kit protocol (GeneAll, South Korea). The First-strand cDNAs were synthesized by GeneAll cDNA synthesis kit (GeneAll, South Korea) and utilized as templates to perform real-time PCR, following the manufacturer’s instruction. The MDM2 gene expression was measured by real-time PCR using a Real Q Plus 2x Master Mix Green (Ampliqon, Denmark). Real time-PCR via cDNAs and specific primers were carried out in annealing temperature at 57°C for 30 seconds. Relative MDM2 expression was normalized to β-actin housekeeping gene and calculated by 2-ΔΔCt. Error bars in control and treated groups show the Standard deviation.
+ Expand
Total RNA was extracted from HCT-116 cells (untreated and treated with apatinib and piperine at different concentrations as mentioned above) using an RNA extraction kit based on the kit protocol (GeneAll, South Korea). The First-strand cDNAs were synthesized by GeneAll cDNA synthesis kit (GeneAll, South Korea) and utilized as templates to perform real-time PCR, following the manufacturer’s instruction. The MDM2 gene expression was measured by real-time PCR using a Real Q Plus 2x Master Mix Green (Ampliqon, Denmark). Real time-PCR via cDNAs and specific primers were carried out in annealing temperature at 57°C for 30 seconds. Relative MDM2 expression was normalized to β-actin housekeeping gene and calculated by 2-ΔΔCt. Error bars in control and treated groups show the Standard deviation.
4
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated during the log phase of the mono-cultures and over six periods during the log phase of the co-cultures. The strains were inoculated into LB broth (Merck, Germany) and then incubated at 37 °C. The RNA was extracted and cDNA synthesis was performed using the GeneAll RNA extraction kit and the GeneAll cDNA synthesis kit (GeneAll, Korea) according to the manufacturer's instructions. Quantitative real-time PCR was used to determine the expressions of lasI, algD, mexR, and KPC genes using the SYBR Green method and rpoD was employed as the reference gene. The primers used from different studies [2, (link)6, 26, 27, (link)33, (link)34] and are listed in Table 1. Each reaction contained 3 µL molecular grade water, 2 µL primers with a nal concentration of 0.5 µM, and 10 µL SYBR Green master mix (Takara Bio, Inc., Otsu, Japan). The ABI StepOne-Plus LightCycler 96 (Applied Biosystems, Foster City, USA) was used. The cycling parameters included one denaturing cycle at 94 o C/15 minutes, followed by 40 three-step cycles of ampli cation (95 o C/30 seconds, 59 o C/30 seconds, and 72 o C/30 seconds). A melting curve was also drawn on the rst run for each sample. The melting curve analysis was performed using a temperature range of 65 o C to 90 o C with a three-second interval. P. aeruginosa ATCC 27853 was used as the negative control. All tests were done in triplicate.
5
Quantitative Analysis of Stemness Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyse the expression of KLF4, SOX2, NANOG and OCT4 key stemness genes, the HT‐29 parental and spheroid cells were washed thrice with cold PBS and total RNAs were isolated using RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer's instruction. To remove genomic DNA contamination, RNA samples were treated with DNase I. RNA quantity and integrity was determined by Nanodrop (ThermoFisher Scientific, USA) and an agarose gel. cDNA was generated using cDNA synthesis kit (GeneAll, Korea). Real‐time polymerase chain reaction (RT‐qPCR) was performed with the SYBR Premix Ex Taq II real‐time PCR kit (TaKaRa, Japan) on the Rotor‐Gene Q LightCycler (Qiagene, Germany). The house‐keeping gene encoding glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as the internal reference gene. Primers are listed in Table 1 .
6
Cardiac mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from frozen heart tissues of all groups using a TRIzol reagent (Sinagene, Tehran, Iran) while cDNA templates were synthesized using a cDNA synthesis kit (Geneall, Seoul, South Korea) according to the manufacturer’s instructions. The expressions were performed using Corbett real-time PCR (USA). Primers were designed using Generunner software (Hastings Software. Inc. Hastings, NY, USA) and NCBI BLAST. The forward and reverse sequences of primers are shown in Table 1 .
7
Adipogenic and Osteogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of adipocyte-specific genes such as PPAR-γ2 and C/EBP-α, and osteocyte-specific genes such as RUNX2 and osteocalcin was assessed by the real-time PCR assay. To this end, the total RNAs of differentiated cells were extracted using the Kiazol reagent (Kiazist Life Sciences, Iran) based on the manufacturer’s instructions. The quantity and quality of isolated RNAs were confirmed by the NanoDrop One UV–Vis Spectrophotometer (Thermo Scientific). In the next step, the cDNAs were synthesized using the cDNA synthesis kit (GeneAll, South Korea) according to the manufacturer’s instructions. The forward and reverse primer sequences listed in Table 1 were employed for the real-time amplification of selected genes by the LightCycler® 96 System (Roche, Germany). The 2−△△Ct method was applied to calculate the relative gene expressions (fold changes), and the expression of RNA Polymerase II (a reference gene) was used to normalize the data.
Primer sequences for adipogenic and osteogenic differentiations.
| Gene name | Sequences | Ta |
|---|---|---|
| PPAR-γ2 | F- CTATTGACCCAGAAAGCGAT R- CGTAATGTGGAGTAGAAATGC | 54 |
| C/EBP-α | F- GGTGCGTCTAAGATGAGGGG R- CATTGGAGCGGTGAGTTTGC | 55 |
| RUNX2 | F- CTCCCCAGGCCAAACACA R- TCCGAGGGCTACCACCTTGA | 55 |
| Osteocalcin | F- CACCGAGACACCATGAGAGC R- CTGCTTGGACACAAAGGCTGC | 54 |
| RPII | F- GCACCATCAAGAGAGTCCAGT R- ATTTGATGCCACCCTCCGTCA | 57 |
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue RNA was purified using RiboEx Total RNA (GeneAll, Seoul, Korea) according to the manufacturer’s instruction. Total RNA (2 μg) was resolved in RNase-free water and was reverse-transcribed with a cDNA synthesis kit (Geneall, Seoul, Korea). Quantitative Real-Time PCR was performed using a SensiFAST SYBT NO-ROS kit (BIOLINE, London, UK) and a CFX Connect System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The primer sequences are shown in Table 1 .
9
Quantitative Analysis of Blood RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were obtained from whole blood using the Hybrid-R™ Blood RNA purification kit (GeneALL, Seoul, South Korea) and then processed with DNase I to eliminate DNA contamination. NanoDrop was used to determine the quantity and quality of isolated RNA (Thermo Scientific, Wilmington, DE, United States). The cDNA synthesis kit (GeneALL) was used to produce complementary DNA (cDNA) in accordance with the manufacturer’s instructions. The cDNA was preserved at 20°C for additional investigation. Table 1 lists the primer sequences used in reverse transcription and quantitative polymerase chain reaction (qPCR) experiments. To normalize miRNA and mRNA levels, internal controls, such as U6 and ubiquitin C (UBC), were used. The qPCR was performed using the Step OnePlus™ Real-Time PCR and the RealQ Plus2x Master Mix (Ampliqon, Odense, Denmark). All qPCRs were accomplished in duplicate.
10
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used a published methodology from our group (Ghafouri-Fard et al., 2021 (link)). Total RNA was extracted from whole blood using Hybrid-RTM Blood RNA purification kit (GeneALL, Seoul, South Korea) according to the manufacturer’s protocol. Assessment of the extracted RNA in terms of quantity and quality was performed by NanoDrop (Thermo Scientific, Wilmington, DE, United States). The synthesis of cDNA was done by the cDNA synthesis Kit (GeneALL) according to the manufacturer’s instructions. The obtained cDNA was stored at −20°C for further investigation. The designing of specific probes and primers for ERMN, LTN1, and HPRT1 was carried out applying Allele ID 7 software (Premier Biosoft, Palo Alto, CA, United States). HPRT1 was chosen because it has been introduced as one of the most stable housekeeping genes in autism studies (Anitha et al., 2012 (link); Nardone et al., 2014 (link); Zhou et al., 2016 (link)). PCR program comprised an initial activation phase for 5 min at 94°C, and 40 cycles at 94°C for 10 s and 60°C for 40 s. Total reaction volumes were 20 μL containing 4 μl of cDNA, 3.5 μl double distilled water, 10 μl of Master Mix 2×, 250 and 900 nM concentrations of probe and each primer, respectively. Table 1 summarizes probes and primers sequences. The qPCR was carried out by the Step OnePlusTM Real-Time PCR and the RealQ Plus2x Master Mix (Ampliqon, Odense, Denmark).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!