Master gradient thermocycler

The specific primers were designed according to the entA sequences of S aureus strain HN2 from National Center for Biotechnology Information (GenBank accession no: c2052229-2051). The amplifications were carried out in 25 µL volumes containing 0.5 µM of each primer (forward: TATACATATGAAAAAAACAGCATTTACA and reverse: ATATCTCGAGACTTGTATATAAATATATATCAAT [italics indicates restriction site of NdeI and XhoI on forward and reverse primers, respectively]), 2.5 µL 10× PCR buffer, 1.5 mM MgSO₄, 0.2 mM nucleotide (dATP, dCTP, dGTP, and dTTP), 2.5 U of Pfu DNA polymerase (Fermentas), and 200 ng genomic DNA. Polymerase chain reaction was carried out in a master gradient thermocycler (Eppendorf, Germany). The gene amplification conditions were as follows—94°C (4 minutes), 35 cycles consisting of 94°C (60 seconds), 56.2°C (60 seconds), and 72°C (60 seconds), and an additional extension time at 72°C (10 minutes). The PCR product was separated by electrophoresis on 1% (w/v) agarose gel (Fermentas) and the desired fragment was recovered from the gel using High Pure PCR Purification Kit (Roche, Germany) (Table 1). The amplified target fragment (1080 bp; Figure 1) was ligated into a linearized pJET1.2 (Fermentas) vector. After ligation and transformation, plasmids were introduced into E coli strain Top10F′ by a chemical method (CaCl₂). A recombinant clone (pJET/entA) was confirmed by sequencing.