QIAamp Viral RNA Mini kit Cat: 52906 (QIAGEN) was used in relation with the protocols to extract viral RNA. The viral RNA was quantified with One Step PrimeScript III RT-qPCR Kit (Takara). A CFX96 Touch instrument was used for all reactions under these quantitative-PCR conditions: 52°C for 5 min, 95°C for 10 sec, followed by 44 cycles at 95°C for 5 sec and 55°C for 30 sec. The CDS primer sequences used for RT-qPCR were targeted against the Nucleocapsid (NC) gene of SARS-CoV-2 with the following primers and probes: N1 Forward: 5ʹ-GAC CCC AAA ATC AGC GAA AT-3ʹ, N1 Reverse: 5ʹ-TCT GGT TAC TGC CAG TTG AAT CTG-3ʹ N1 Probe: 5ʹ-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3 N2 Forward: 5ʹ-TTA CAA ACA TTG GCC GCA AA-3ʹ N2 Revers: 5ʹ-GCG CGA CAT TCC GAA GAA-3ʹ N2 Probe: 5ʹ-FAM-ACA ATT TGC CCC CAG CGC TTC AG-HQ1-3. RT-PCR experiments were performed in duplicate.
One step primescript 3 rt qpcr kit
Manufactured by Takara Bio
Sourced in Japan
The One Step PrimeScript III RT-qPCR Kit is a reagent designed for one-step reverse transcription and real-time quantitative PCR (RT-qPCR) analysis. The kit contains the necessary components for the reverse transcription of RNA samples and the subsequent quantification of target gene expression levels.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Magna pure 96 cellular rna large volume kit, by Roche (1 mentions)
Rotor gene q, by Qiagen (1 mentions)
Magna pure 96 system, by Roche (1 mentions)
Minibest universal rna extraction kit, by Takara Bio (1 mentions)
6 protocols using one step primescript 3 rt qpcr kit
1
SARS-CoV-2 RNA Extraction and Quantification
2
Quantitative Cytokine Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of cellular IFN-γ, IL-2, TNF-α and IL-4 mRNAs were measured using one-step RT-qPCR protocol. Total RNA of the stimulated PBMCs was isolated using RNeasy Mini kit (Qiagen) or MagNA Pure 96 Cellular RNA Large Volume Kit in MagnaPure 96 System (Roche) according to manufacturer’s protocols. For amplification and quantitation, 5 µl of purified RNA was used in One Step PrimeScript III RT-qPCR Kit (Takara Bio Inc) with predesigned TaqMan FAM-MGB IFN-γ (Hs00989291_m1), IL-2 (Hs00174114_m1), IL-4 (Hs00174122_m1), TNF-α (Hs00174128_m1) and β-actin (Hs01060665_g1) primer/probe sets (Thermo Fisher Scientific) in Rotor-Gene Q (Qiagen). The conditions for the qRT-PCR thermal cycling were the following: One reverse transcription cycle at 55°C for 10 min and 95°C for 10 sec followed by 45 amplification cycles at 95°C for 5 sec and 58°C for 30 sec. The relative fold changes of the target genes were obtained with the 2−ΔΔCt method by using β-actin Ct-values for normalization and for each participant their corresponding DMSO treated sample as the calibrator.
3
SARS-CoV-2 RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted with the QIAamp Viral RNA Mini kit Cat: 52906 (QIAGEN) according to the protocols. The viral RNA quantification was performed using One Step PrimeScript III RT‐qPCR Kit (Takara). All reactions were performed on a CFX96 Touch instrument with the following quantitative‐PCR conditions: 52 °C for 5 min, 95 °C for 10 s, followed by 44 cycles at 95 °C for 5 s and 55 °C for 30 s. The CDS primer sequences used for RT‐qPCR were targeted against the Nucleocapsid (N) gene of SARS‐CoV‐2 with the following primers and probes: N1 Forward: 5’‐GACCCCAAAATCAGCGAAAT‐3’, N1 Reverse: 5’‐TCTGGTTACTGCCAGTTGAATCTG‐3’ N1 Probe: 5’‐FAM‐ACCCCGCATTACGTTTGGTGGACC‐BHQ1‐3 N2 Forward: 5’‐TTACAAACATTGGCCGCAAA‐3’ N2 Reverse: 5’‐GCGCGACATTCCGAAGAA‐3’ N2 Probe: 5’‐FAM‐ACAATTTGCCCCCAGCGCTTCAG‐BHQ1‐3.
4
SARS-CoV-2 Detection Using Biplex RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Biplex RT-PCR assay was conducted for the Viroselect assay. The ORF1a (nsp3) gene for the detection of SARS-CoV-2 virus along with human RNase P was used as the internal control from human patient samples. The primer and probe concentrations were as follows: 0.5 μmol/L for primers and 0.5 μmol/L for probes for ORF1a (nsp3); and 0.5 μmol/L for primers and 0.2 μmol/L for probes for human RNaseP. The TaqMan probe was labelled with 6-carboxyfluroscien (6-Fam) 5′ and BHQ1 3′ for ORF1a, and with Cy5 at the 5′ end and BHQ3 at the 3′ end for the RNase P probe. A One Step PrimeScript III RT-qPCR kit (Catalogue number: RR600A, Takara Bio, Kyoto, Japan) along with gene specific primers (ORF1a and RNaseP) was used for real-time RT-PCR reaction, in accordance with the manufacturers’ protocol. The one-step RT-PCR conditions were: 52 °C for 5 min (one cycle for reverse transcription), 95 °C for 10 s (initial denaturation), 95 °C for 5 s and 60 °C for 30 s (PCR reaction of 40 cycles).
5
Quantifying p65 Transcription Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The p65 transcription level was determined via RT-qPCR. Total RNA was extracted using the MiniBEST Universal RNA Extraction Kit (TaKaRa, cat. no. 9767), according to the manufacturer’s instructions. A One Step PrimeScript III RT-qPCR kit (TaKaRa, cat. no. RR600A) was used for the RT-qPCR analysis. The reaction solution was prepared according to the manufacturer’s instructions and applied in a Thermal Cycler Dice Real Time System. GAPDH was used as an internal control. The PCR primer sequence of p65 and GAPDH was as follows: p65 forward, 5′-CGCGGATCCGCCACCATGGACGAACTG-3′ and reverse, 5′-CCGCTCGAGTTAGGAGCTGATCTG-3′; GAPDH forward, 5′-CTTTGGTATCGTGGAAGGACTC-3′ and reverse, 5′-GTAGAGGCAGGGATGATGTTCT-3′. The relative expression of p65 was calculated using the 2−ΔΔCq method.
6
Quantitative RT-qPCR Analysis of Wound Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative Reverse Transcriptase Polymerase Chain Reaction was performed with the infected wound tissue at specific observation times to study the measure of relative fold change in expression of the genes associated with wound inflammation and repair. Total RNA was extracted from the infected wound tissue using RNeasy Mini Kit (Qiagen) and the RNA quality was confirmed by determining absorbance ratio at 260/280 nm and quantified using nanodrop (Thermofisher). Gene expression pattern was analysed using the One Step Primescript III RT-qPCR Kit (TAKARA) normalised to β-actin, the housekeeping gene [37 (link)]. Relative fold change was computed using the ∆∆CT method [38 (link)].
Using Zebrafish gene specific primers the expression levels of pro-inflammatory cytokines, IL-6 [39 (link)], TNF-α [37 (link)] and the anti-inflammatory cytokine IL-10 [37 (link)] were measured in the wound infected tissue at 12 h, 1 and 3 dpi. The fold change in iNOS [40 (link)] expression was measured in the control and treated groups on 5 and 7 dpi [41 (link)].
Using Zebrafish gene specific primers the expression levels of pro-inflammatory cytokines, IL-6 [39 (link)], TNF-α [37 (link)] and the anti-inflammatory cytokine IL-10 [37 (link)] were measured in the wound infected tissue at 12 h, 1 and 3 dpi. The fold change in iNOS [40 (link)] expression was measured in the control and treated groups on 5 and 7 dpi [41 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!