T3 mmessage kit

We utilized ZiFiT Targeter (http://zifit.partners.org/ZiFiT/) to identify gRNA binding sites for gata3. With these target sites, we made gata3 gRNA via MEGAscript T7 Kit and Cas9 mRNA via T3 mMessage Kit (Invitrogen) using a described protocol [59 (link)]. Embryos were injected with a 2nl bolus of a cocktail containing: 100ng/ul Cas9 mRNA, 50ng/ul gata3 gRNA in water and phenol red (to visualize the injection).
Embryos were genotyped using either Restriction fragment length polymorphism (RFLP) or High-resolution melt (HRM) analysis. For RFLP we used forward 5’-GGTATGACGAATCCCACAACAGAC-3’ and reverse 5’- AAGAGGACCCACCTATCAGGCTAC3’ primers. Digestion with NlaIV results in a 531bp mutant band and 394 and 139 wild type fragments. Primers for HRM analyses were forward GGCAAATCTATCGGCCCTCA and reverse GGACAGCGAGGAGGAAGAAG. The resulting product is 129 bp.

We generated germline mutant alleles using CRISPR/Cas9 mutagenesis (Hwang et al., 2013 (link)) with modifications as described (Mitchell et al., 2021 (link)). Briefly, we designed sgRNAs(Single-guide RNA) within or just downstream of the MADS or MEF2 domain. The XbaI-digested pT3TS-nCas9n plasmid (Addgene plasmid #46757) was used as a template to transcribe Cas9 mRNA with the T3 mMESSAGE kit (Invitrogen). We transcribed sgRNAs (see table below) from PCR-generated templates using the MEGAscript T7 Kit (Thermo Fisher Scientific). One cell-stage embryos were injected with a mix of 200 ng/µl Cas9 mRNA and 50 ng/µl of each gene-specific sgRNA. Injected embryos were raised, and founders identified by amplifying the genomic region containing the sgRNA site and identifying banding size shifts indicating insertions and/or deletions (see genotyping assay table for primers). All new paralog mutants were originally generated in the low-penetrance strain and were subsequently maintained on the AB background for at least three generations. The following sgRNAs were used: mef2d^co3013: 5’-GGACAAATACCGGAAGAGCG-3’; mef2b^co2012: 5’-CACGAGAGCCGCACTAACAC-3’;mef2aa^co3017: 5’-TCATGGACGACCGTTTCGGC-3’.We generated six independent sgRNAs for mef2ab, and none of them mutagenized this locus. Precise sequences of mutant alleles are indicated below:

pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with XbaI, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). For rps9 mRNA synthesis, coding sequence was amplified using cDNA and cloned into pCSDest2 using gateway technology (Thermo Fisher), then mRNA was transcribed after plasmid linearization using SP6 mMESSAGE Kit (Ambion). Rescue experiment was performed by injecting 400 pg rps9 mRNA to the embryos at one cell stage. For gRNA synthesis, DNA template was amplified using gene specific oligo (rps9 guide F: TAATACGACTCACTATAGCGTATTGGAGTGCTGGATGGTTTTAGAGCTAGAAATAGC), then gRNA was transcribed in vitro using MAXIscript T7 kit (Ambion) and purified using MicroRNA Isolation Kit (BioChain USA). 200 pg of Cas9 mRNA and 100 pg of gRNA were mixed and injected into embryos at the one-cell stage. For genotyping, PCR products were amplified from genomic DNA and subjected to electrophoresis using 8% TBE-PAGE gel with the following primers: rps9 Fwd: 5′-TTCCTCGTCAATGAGGCCAT-3′ and rps9 Rev: 5′-CTTTGCACATGTAGTTAGCA-3′. PCR products showing positive bands were further cloned and sequenced.