We measured levels of GRP78, CHOP, and ATF4, components of three canonical branches of UPR, by Western blot analysis using the spinal cord tissues and MEFs from membralin KO mice and WT littermates. The antibodies against these proteins were purchased from commercial sources: GRP78 (H-129, 1:1000; Santa Cruz Biotechnology, Santa Cruz, CA), CHOP (2895S, 1:1000; Cell Signaling, Denvers, MA), and ATF4 (SC200, 1:500; Santa Cruz Biotechnology). Total RNA was isolated from the spinal cord of membralin mutant mice and WT littermate using TRIzol reagent (Life Technologies). The following set of primers was used to detect the expression of mouse Xbp-1 (GATCCTGACGAGGGTCCAAGA and ACAGGGTCCAACTTGTCCAG).
Grp78 h 129
Manufactured by Santa Cruz Biotechnology
GRP78 (H-129) is a primary antibody developed by Santa Cruz Biotechnology for use in various research applications. It is designed to detect the GRP78 protein, which is a molecular chaperone involved in the unfolded protein response within the endoplasmic reticulum. The antibody can be utilized in techniques such as Western blotting, immunoprecipitation, and immunohistochemistry to study the expression and localization of GRP78 in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Chop 2895, by Cell Signaling Technology (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Proliferating cell nuclear antigen (pcna), by BD (1 mentions)
Grp94, by Enzo Life Sciences (1 mentions)
α sma, by Merck Group (1 mentions)
Vectashield mounting medium with dapi, by Vector Laboratories (1 mentions)
E cadherin, by BD (1 mentions)
2 protocols using grp78 h 129
1
Measuring UPR Pathway Components
2
Immunohistochemical Analysis of Mouse Mammary Glands
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse mammary glands were isolated and fixed overnight in 10% buffered formalin followed by embedding in paraffin. Paraffin-embedded tissues were sectioned and stained with hematoxylin and eosin (H&E). The immunofluorescent and immunohistochemical staining were performed as described previously29 (link). Paraffin sections were incubated at 4°C overnight with primary antibodies against GRP94 (Enzo Life Sciences, 1:200), GRP78 (H-129, Santa Cruz, 1:100), PCNA (BD BioScience, 1:100), E-cadherin (BD BioScience, 1:150) or α-SMA (Sigma, 1:2000). For immunofluorescent staining, the slides were mounted with VECTASHIELD mounting medium with DAPI (Vector Laboratories).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!