Phospho foxo3a s253

MDA-MB-231 and BT-549 cells were treated with 40μg/mL and 25μg/mL aplysin respectively for 12h and 24h. Cell lysates were used for WB analysis. Antibodies to AKT (CellSignaling Technology, Beverly, MA; Cat.#2920), phospho-AKT (S473) (Cell Signaling Technology, Beverly, MA; Cat.#4060), FOXO3a (Cell Signaling Technology, Beverly, MA; Cat.#2497), phospho-FOXO3a (S253) (Cell Signaling Technology, Beverly, MA; Cat.#9466) and Tubulin (Santa Cruz, CA, USA; Cat.#sc-32292) and β-Actin (Santa Cruz, CA, USA; Cat.#sc-47778) were used for detection. Forty microgram protein was subjected to SDS-PAGE and western blot was carried out as described previously [43 (link)].

BKM120 (S2247) and hydroxychloroquine (S4430) were purchased from Selleck Chemicals. BV02 (SML0140) was purchased from Sigma-Aldrich. Antibodies against the following proteins were used in this study: phospho-Akt S473 (Santa Cruz Biotechnology, sc-7985-R), Akt (Santa Cruz Biotechnology, sc-8312), α-tubulin (Santa Cruz Biotechnology, sc-8035), pan-14-3-3 (Santa Cruz Biotechnology, sc-629), 14-3-3ζ (Santa Cruz Biotechnology, sc-1019), p27 (Santa Cruz Biotechnology, sc-1641), β-actin (Santa Cruz Biotechnology, sc-47778), cleaved caspase-3 (Cell Signaling Technology, #9661), phospho-FOXO3a S253 (Cell Signaling Technology, #13129), FOXO3a (Cell Signaling Technology, #2497), LC3B (Abcam, ab48394), ATG7 (MBL, PM039), and di-methyl histone H3 (Lys9) (Cell Signaling Technology, #9753). The LC3B-EGFP expression vector (#11546) and the FHRE-luc reporter vector (#1789) were from Addgene (Cambridge, MA). The siRNAs used in the present study included ATG7 siRNA (Ambion, Silencer® Select Pre-designed siRNA, Cat#s20651), 14-3-3ζ siRNA (Invitrogen, Stealth siRNA™, cat#5480996), FOXO3a siRNA (Invitrogen, Stealth siRNA™, Cat#5436311), and negative control siRNA (Bioneer, SN-1022).

Primary antibodies against p53, Phospho-Akt (S473), total-Akt, Phospho-FoxO3a (S253), total-FoxO3a, Phospho-ERK (Thr202/Tyr204), total-ERK, PUMA, Bax and cleaved Caspase3, β-actin were purchased from cell signaling; α-tubulin antibody was from Santa Cruz Technologies. Lipofectamine™ Reagent was purchased from Invitrogen. HRP-conjugated anti-rabbit and or anti-mouse secondary antibodies an ECL-plus kit were from GE Healthcare. 5-FU was purchased from APP Pharmaceuticals. Cisplatin and regofenib were purchased from Axon Medchem. Other chemicals were mainly from Sigma. The plasmid of expressing PUMA was kindly supplied by Jian Yu, Ph.D. [31 (link)]. The oligonucleotide for shFOXO3a was synthesized as 5′-CACCGACTCCGGGTCCAGCTCCACTTCAAGA GAGTGGAGCTGGACCCGGAGTTTT TTTG-3′.