Cfx96 qrt pcr system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The CFX96 qRT-PCR system is a real-time PCR detection system designed for quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. The system provides accurate and sensitive detection of target sequences.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions) Hiscript 2 q rt supermix for qpcr kit, by Vazyme (2 mentions) Trizol, by Sangon (1 mentions)

Close spelling variants of this product

QRT-PCR (101 citations) CFX96 (17 citations) QRT-PCR system (16 citations) CFX96 system (5 citations)

2 protocols using cfx96 qrt pcr system

Quantitative RT-PCR Analysis of DR4 and DR5

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with TRIzol (Sangon Ltd., China). RNA concentration was detected by a Nanodrop spectrophotometer (Thermo Scientific Ltd., USA). Total RNA (500 ng) was used for the synthesis of first-strand cDNA using HiScript® II Q RT SuperMix for qPCR kit (Vazyme Ltd., China). The following primers were used:

DR4:

forward 5'-ACCTTCAAGTTTGTCGTCGTC-3' and reverse 5'-CCAAAGGGCTATGTTCCCATT-3';

DR5:

forward 5'-ACAGTTGCAGCCGTAGTCTTG -3' and reverse 5'- CCAGGTCGTTGTGAGCTTCT -3';

GAPDH:

forward 5'-TGGAAGGACTCATGACCACA-3' and reverse 5'- TCAGCTCAGGGATGACCTT -3'.
The qRT-PCR reactions were performed using a CFX96 qRT-PCR system (Applied Biosystems Ltd., USA) according to the manufacturer's instruction. The 2^-ΔΔCT method was used to calculate the fold changes. GAPDH was used as an internal control for the normalization of target gene expression.

You C., Sun Y., Zhang S., Tang G., Zhang N., Li C., Tian X., Ma S., Luo Y., Sun W., Wang F., Liu X., Xiao Y., Gong Y., Zhang J, & Xie C. (2018). Trichosanthin enhances sensitivity of non-small cell lung cancer (NSCLC) TRAIL-resistance cells. International Journal of Biological Sciences, 14(2), 217-227.

+ Open protocol

+ Expand

PD-L1 Gene Expression Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol (Sangon Ltd., China) was used to extract total RNA. RNA concentration was detected by a Nanodrop spectrophotometer (Thermo Scientific Ltd., USA). Total RNA (1 μg) was used for the synthesis of first-strand cDNA and reverse transcription reactions were conducted using HiScript® II Q RT SuperMix for qPCR kit (Vazyme Ltd., China). The following primers were used: PD-L1 (forward 5'- GCTGCACTAATTGTCTATTGGGA -3' and reverse 5'- AATTCGCTTGTAGTCGGCACC -3'); GAPDH (forward 5'- GGAGCGAGATCCCTCCAAAAT -3' and reverse 5'- GGCTGTTGTCATACTTCTCATGG -3'). The qRT-PCR reactions were performed using a CFX96 qRT-PCR system (Applied Biosystems Ltd., USA). We used the 2-ΔΔCT method to calculate the fold changes. Data were normalized to GAPDH levels.

Luo Y., Ma S., Sun Y., Peng S., Zeng Z., Han L., Li S., Sun W., Xu J., Tian X., Wang F., Wu Q., Xiao Y., Zhang J., Gong Y, & Xie C. (2021). MUC3A induces PD-L1 and reduces tyrosine kinase inhibitors effects in EGFR-mutant non-small cell lung cancer. International Journal of Biological Sciences, 17(7), 1671-1681.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!