Qiaamp viral rna lysis kit

To collect viral RNA, 160 µL of apical wash was mixed with 560 µL of buffer AVE from QIAamp Viral RNA Lysis kit (Qiagen Cat. # 52906). RNA isolation proceeded according to the manufacturer's instructions. After RNA isolation, cDNA was generated using from 5 µL of RNA template using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, Cat. # 18080093) and random primers (Thermo Fisher Scientific, Cat. # 4819011). Quantification of SARS‐CoV‐2 was performed using qRT‐PCR using iTaq Universal SYBR® Green Supermix (Bio‐Rad, Cat. # 1725120) using primers directed against SARS‐CoV‐2 N gene (IDT, Cats. # 158337930 and 158337962). Absolute quantification was achieved using a standard curve generated from a vector containing the SARS‐CoV‐2 nucleoprotein gene (IDT, Cat. # 165520002). Quantification of low‐pathogenic viruses 229E, OC43, and NL63 was performed using the following primer pairs directed against their respective CoV nucleoprotein genes— 229E Forward: 5’‐TCCACAATTTGCTGAGCTTG‐3’, 229E Reverse: 5’‐CCCAAGTGTGGATGGTCTTT‐3’, OC43 Forward: 5’‐AGTCTACTGGGTCGCTAGCA‐3’, OC43 Reverse: 5’‐CTCATCGCTACTTGGGTCCC‐3’, NL63 Forward: 5’‐TCAACCCAGGGCTGATAAGC‐3’, NL63 Reverse: 5’‐CACGAGGACCAAAGCACTGA‐3’. Relative quantities of 229E, OC43, and NL63 virus shed were calculated by measuring the delta‐CT values between nafamostat treated and untreated controls.