To prepare E. faecalis-incubated PBS solutions, E. faecalis cells were pelleted from an exponential phase culture, washed three times with buffered PBS and resuspended in buffered PBS to an OD600 of 1. The E. faecalis-containing PBS solution was then incubated at 37°C under micro-aerobic conditions (N2 90%, CO2 5%, O2 5%) for 2 h and centrifuged (10 min at 17,000 x g, 4°C). The supernatant was collected by filtration (0.22 μm) and used to measure H2O2 production and F. nucleatum killing capacity. For the catalase rescue assay, 2.5 mg of catalase (Thermo Scientific, USA) was added to 1 ml E. faecalis-incubated PBS solution or fresh unbuffered PBS solution and incubated at 37°C anaerobically for 12 h. Then, exponential phase F. nucleatum cells were added to the solutions, incubated under micro-aerobic conditions for 2 h, and assayed for viability.
Catalase
Manufactured by Thermo Fisher Scientific
Sourced in United States
Catalase is a common enzyme found in nearly all living organisms exposed to oxygen. It acts as a catalyst to decompose hydrogen peroxide (H2O2) into water (H2O) and oxygen (O2). Catalase helps protect cells from the oxidative damage of hydrogen peroxide.
Automatically generated - may contain errors
Lab products found in correlation
Gapdh, by Thermo Fisher Scientific (2 mentions)
Glutathione peroxidase, by Thermo Fisher Scientific (2 mentions)
β actin, by Thermo Fisher Scientific (1 mentions)
Qiazol lysis reagent, by Qiagen (1 mentions)
Nuclease free water, by Thermo Fisher Scientific (1 mentions)
Tgf β, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Quantitect probe pcr kit, by Qiagen (1 mentions)
Glyceraldehyde 3 phosphate dehydrogenase, by Thermo Fisher Scientific (1 mentions)
Rotor gene 3000 system, by Qiagen (1 mentions)
Sod 2, by Thermo Fisher Scientific (1 mentions)
Catalase, by Merck Group (1 mentions)
3 4 5 dimethyl 2 thiazolyl 2 5 diphenyl 2h tetrazolium bromide mtt, by Merck Group (1 mentions)
Streptozotocin (stz), by Merck Group (1 mentions)
Luteolin, by Merck Group (1 mentions)
S nitrosylated protein detection kit biotin switch, by Cayman Chemical (1 mentions)
10 protocols using catalase
1
Preparation and Characterization of E. faecalis-Conditioned PBS
2
Quantitative Analysis of Gene Expression
3
Mammary Gland RNA Extraction and qPCR
4
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the QIAzol Lysis Reagent (Qiagen) according to the manufacturer’s instructions and diluted in nuclease-free water (Ambion/Life Technologies). cDNA was generated from total RNA using the High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems). Real-time polymerase chain reaction was performed with the Applied Biosystems 7900HT Fast Real-Time PCR system, using Fast SyBr Green Master Mix (Applied Biosystems) and specific human primers to GAPDH, IL-6, MCP-1, TNFα, VCAM-1, PAI-1, thrombin, angiopoietin-2, TGFβ, preproET-1, SOD-1, catalase, glutathione peroxidase, peroxiredoxin, heme oxygenase-1 and thioredoxin; all acquired from Eurofins genomics (Glasgow, UK). Relative gene expression was calculated by the 2-∆∆Ct cycle threshold method as previously described41 (link).
5
Quantitative RT-PCR Analysis of Hypoxia Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was prepared with RNeasy mini kit from Qiagen (Qiagen, cat #74106). Reverse transcription was performed on 1 μg of total RNA using iScript cDNA Synthesis kit (Bio-Rad, cat #170-8891). RNA samples that were not reverse transcribed were used as “Non-RT control”. The pre-designed primers and probe sets of HIF-1, SOD2, catalase, Map1lc3b and glyceraldehyde-3-phosphate dehydrogenase were obtained from Applied Biosystems (assay identifications are as follows: Rn00577560_m1, Rn00690588_g1, Rn00560930_m1, Rn02132764_s1 and Rn01775763_g1) The reaction mixture was prepared using a Quantitect probe PCR kit (Qiagen, cat #204345) according to the manufacturer's instructions. Reaction and analysis were performed using the Rotor-Gene 3000 system (Corbett Research). All reactions were done in triplicate. The amount of mRNA was calculated by the comparative CT method.
6
Generation of GFP- and FLAG-tagged ACBD4iso2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Myc-VAPB plasmid was kindly provided by C. Miller (King's College London, UK). A human ACBD4iso2 cDNA clone (Cusabio Life Sciences, http://www.cusabio.com/Clone/ACBD4–158327.html) was used as a template to generate GFP-ACBD4iso2 and FLAG-ACBD4iso2 using eGFP-C1 and pCMV-2B vectors respectively. Primers: ACBD4_iso2_GFP_For = AAACTCGAGCTATGGGCACCGAG AAAGAAAGCCCAGAGCCCGAC, ACBD4_iso2_GFP_Rev = TTGGATCCTCACCTC TTTTGGGTCCGAAACATTCGGAAGAGCC (XhoI, BamHI digest into eGFP-C1).
ACBD4_myc_For = AAGGATCCATGGGCACCGAGAAAGAAAGCCCAGAGCCCGAC, ACBD4iso2_myc_Rev = CTCTCGAGTCACCTCTTTTGGGTCCGAAACATTCGGAAGA GCC (XhoI, BamHI digest into pCMV2B). Antibodies were as follows: polyclonal rabbit anti-PEX14 (kindly provided by D. Crane, Griffith University, Brisbane, Australia); anti-catalase (Abcam,catalase-antibody-ab88650.html">http://www.abcam.com/catalase-antibody-ab88650.html) ; anti-GFP (Thermofisher, https://www.thermofisher.com/antibody/product/GFP-Tag-Antibody-Polyclonal/A-11122) ; anti-Myc (Abcam, http://www.abcam.com/myc-tag-antibody-ab9106.html) ; anti-FLAG (SIGMA, http://www.sigmaaldrich.com/catalog/product/sigma/f3165?lang = enandregion = GB).
ACBD4_myc_For = AAGGATCCATGGGCACCGAGAAAGAAAGCCCAGAGCCCGAC, ACBD4iso2_myc_Rev = CTCTCGAGTCACCTCTTTTGGGTCCGAAACATTCGGAAGA GCC (XhoI, BamHI digest into pCMV2B). Antibodies were as follows: polyclonal rabbit anti-PEX14 (kindly provided by D. Crane, Griffith University, Brisbane, Australia); anti-catalase (Abcam,
7
Oxidative Stress in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type C. elegans at the L4 stage were cultured in the presence of 0.05 g/L FUDR to prevent reproduction. After 3 days of growth, worms were harvested, washed with pre-chilled PBS buffer (KH2PO4 30 g/L, K2HPO4 60 g/L, NaCl 50 g/L) for three times, and then incubated with or without 5 mM H2O2 for 5 min. After being washed with PBS containing 200 unit/mL catalase for three times, C. elegans pellets were lysed in four volumes of pre-chilled NETN buffer (50 mM HEPES (pH = 7.6), 150 mM NaCl, and 1% IGEPAL) supplemented with 1× protease and phosphatase inhibitors (Thermo Fisher Scientific, A32961) containing 200 unit/mL catalase (Sigma-Aldrich) using Retsch homogenizer (Retsch GmbH, MM400).
8
Luteolin Attenuates Diabetic Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Luteolin, streptozotocin (STZ), Nω-nitro-L-arginine methyl ester hydrochloride (L-NAME), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (Saint Louis, MO, USA). The nuclear extraction kit and antibodies to Nrf2 and Keap1 were from Abcam (Cambridge, MA, USA). The antibody to histone H3 was from Cell Signaling Technology (Beverly, MA, USA). Primers of HO-1, SOD, GPx, catalase, and GAPDH for PCR were purchased from Thermo Fisher (Grand Island, NY, USA). The S-nitrosylated protein detection kit (Biotin Switch) was from Cayman Chemical (Ann Arbor, MI, USA). DNA binding ELISA for activated Nrf2 (TransAM® Nrf2) was purchased from Active Motif (Carlsbad, CA, USA). ELISA kits for 8-hydroxydeoxyguanosine (8-OHdG) were from USCN Life Science (Wuhan, China). The kits for measurement of lactate dehydrogenase (LDH) and malondialdehyde (MDA) were from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Luteolin was dissolved in 0.5% (w/v) sodium carboxymethyl cellulose (CMC-Na). All other reagents were of analytical purity.
9
Bacterial Culturing Conditions for M. marinum and E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mycobacterium marinum M bacterial strains were grown on Middlebrook’s 7H11 (Sigma-Aldrich) agar plates supplemented with 10% OADC [oleic acid (Fischer Scientific), dextrose (Sigma and VWR), albumin (Sigma Aldrich), and catalase(Fischer)] and 0.5% glycerol (VWR, Radnor, PA) at 30°C or in Middlebrook’s 7H9 media (Sigma-Aldrich, St. Louis, MO) supplemented with 10% OADC and 0.2% tyloxapol (Chem-Impex Int’l Inc., Wood Dale, IL) at 30°C. Hygromycin (EMP Millipore) and Kanamycin (IBI Scientific, Peosta, IA) were added to final concentrations of 50 μg/mL and 20 μg/mL, respectively, where noted. Escherichia coli was grown on Luria-Bertani (LB) agar or in LB broth at 37°C. Kanamycin, Hygromycin, and Ampicillin (VWR) were added to final concentrations of 50 μg/mL, 200 μg/mL, and 200 μg/mL when stated. Please see S1 Table for a complete list of bacterial strains used in this study.
10
Quantifying Catalase mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by a single step of guanidinium isothiocyanate/phenol extraction using PureZol RNA isolation reagent (Bio-Rad Laboratories, Italy) and quantified by spectrophotometric analysis as previously described [32 (link)]. An aliquot of each sample was treated with DNase (ThermoFisher scientific, Italy) to avoid DNA contamination. Real-time polymerase chain reaction (RT-PCR) was performed to assess Catalase (Cat) (Rn00560930_m1, ThermoFisher scientific, Italy) mRNA levels. RNA was analysed by TaqMan qRT-PCR instrument (CFX384 real time system, Bio-Rad Laboratories, Italy) using the iScriptTM one-step RT-PCR kit for probes (Bio-Rad Laboratories, Italy) (see Brivio et al. [3 (link)] for details). Samples were run in 384 well formats in triplicate as multiplexed reactions with the normalizing internal control 36B4 (primer fw TCAGTGCCTCACTCCATCAT, primer rev AGGAAGGCCTTGACCTTTTC, probe TGGATACAAAAGGGTCCTGG). A comparative cycle threshold (Ct) method was used to calculate the relative target gene expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!