Salmon sperm dna

Silk cocoons were supplied by a local farm (Fimo srl, Milano, Italy). Sodium hydrogen carbonate (NaHCO₃), CaCl₂, and formic acid (FA) were provided by Merck (Darmstadt, Germany). Salmon sperm DNA (double-stranded DNA, molecular weight = 5 × 10³ g/mol, 23 base pairs) was purchased from Merck (Darmstadt, Germany). Human keratinocytes (HaCaT cell lines) were purchased from I.Z.S.L.E.R. from the Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna ‘Bruno Ubertini’ (Brescia, Italy). Cells were grown in 75 cm² tissue flasks with DMEM medium supplemented with 100 U/mL penicillin, 100 μg/mL streptomycin, 2 mM L-glutamine, and 10% FBS under a humidified atmosphere of 5% CO₂ at 37 °C.

Chromatin immunoprecipitation was performed as described previously22 (link) with following modifications. In brief, embryos injected with human ESRRa mRNA and raised to 36 hpf were dissociated into single cells and crosslinked in 1% formamide solution. Samples were sonicated with 35% amp for a total of 2 minutes using Epishear Probe Sonicator (Active Motif, USA) and then pre-cleared using 80 μl of protein A agarose slurry containing salmon sperm DNA (Merck Millipore Corp., USA) for 1 hour at 4 °C. Samples were spun and supernatants were divided equally into 2, each labelled as an antibody or a control. 40 ul of protein A agarose slurry was added to both samples and 1 μg anti-ESRRa antibody (Abcam, USA) was added only to the samples labelled as antibody. All the remaining steps were followed as described. Primer sequences for quantitative PCR are: esrra (F-5′AAACACCACCTCACCTGCACATATTG3′, and R-5′GTCAGAGCGTCGTT CTCTGGAAG3′), sox9b-1 (F-5′GTGTGAGATCAGAGTTAATAAAGGTCA3′ and R-5′CCCAGCCAATCACAGTCAGTTAGCA3′), sox9b-2 (F-5′ CTCCACACAGAAACACCAACTGACCC3′ and R-5′ TACGTGCAGAGTGGCGGCACGGT3′). Statistical analysis was performed using IBM SPSS Statistics 22 software (International Business Machines Corp., USA). Values with p < 0.05 (indicated by asterisks) were considered to be statistically significant.

Daclatasvir and TAR were kindly provided from GLOBAL NAPI Pharmaceuticals (Giza, Egypt), while VAC was gifted from EVA Pharma Pharmaceuticals (6th October city, Egypt). Salmon sperm DNA, Tris–HCl and ethylenediamine were purchased from Merck KGaA (Darmstadt, Germany). Potassium chloride crystals was purchased from the El-Nasr Company for Pharmaceutical Chemicals (Abozabaal, Egypt).

Briefly, 10 million cancer cells were cross-linked with 1% formaldehyde and resuspended in lysis buffer. The cell lysate was sonicated on ice resulting in an average DNA fragment length of 500 bp. After centrifugation, immunoprecipitation was performed in ChIP dilution buffer overnight in the presence of IgG, H3K9me3, and GATA3 antibodies with agitation. The protein A agarose/Salmon Sperm DNA (Merck Millipore) slurry was added and incubated for 2 to 4 h at 4°C with agitation. The antibody-agarose complex was centrifuged and washed five times, and the immunoprecipitated fraction was eluted. The cross-linking was reversed by incubation at 65°C for 4 h. The DNA was recovered by phenol/chloroform extraction and precipitated, and the abundance of specific sequence was measured by qRT-PCR using the corresponding primer sequences (Supplementary Table S2).