Total RNA was isolated from rice using the Eastep Universal RNA Extraction Kit (Promega, United States). First-strand cDNA was synthesized from DNase I-treated total RNA using the HiScript II First-Strand cDNA Synthesis Kit (Vazyme, China). Quantitative Real-time PCR (qRT-PCR) was performed on ABI 7500 RT-PCR system (Applied Biosystems, United States) using SYBR Green Premix Pro Taq HS qRT-PCR Kit II (Accurate, China) according to the protocol of the manufacturer. Rice UBQ5 (Os01g0328400) was used as an endogenous control. Relative expression levels were determined as described previously (Livak and Schmittgen, 2001 (link)).
Hiscript 2 first strand cdna synthesis kit
Manufactured by Vazyme
Sourced in China, Japan
The HiScript II First Strand cDNA Synthesis Kit is a tool for reverse transcription, converting RNA into complementary DNA (cDNA). It includes all the necessary reagents and enzymes to efficiently perform this process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Lightcycler 480, by Roche (4 mentions)
Dnase 1, by Takara Bio (3 mentions)
Trizol reagent, by Vazyme (3 mentions)
Sybr green master mix, by Vazyme (2 mentions)
Sybr green qpcr master mix, by Vazyme (2 mentions)
Total rna extraction reagent, by Transgene (2 mentions)
Trizol solution, by Vazyme (2 mentions)
Rna isolator, by Vazyme (2 mentions)
Rna purification kit, by Tiangen Biotech (2 mentions)
All in one mirna first strand cdna synthesis kit, by GeneCopoeia (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol, by Takara Bio (2 mentions)
Chamq sybr qpcr master mix, by Vazyme (2 mentions)
Sybr green, by Vazyme (2 mentions)
Aceq qpcr sybr green master mix, by Vazyme (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
55 protocols using hiscript 2 first strand cdna synthesis kit
1
Quantifying Rice Gene Expression by qRT-PCR
2
Quantification of RABV gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BV2 cells infected with RABV were harvested using TRIzol reagent (Magen, Guangzhou, China) according to the manufacturer’s instructions at indicated time points. Reverse transcription was performed using the HiScript II First Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Each sample was tested in triplicate using the SYBR Green Master Mix (Vazyme). Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) was performed using a CFX connect real-time system (Bio-Rad, Hercules, CA, United States). The levels of N mRNA, P mRNA, M mRNA, G mRNA, L mRNA, and genome RNA (gRNA) were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primers are shown at the bottom of this article (Table 1
3
Quantifying mRNA Levels of IDH1 and Nrf2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using E.Z.N.A total RNA kit II (OMEGA, Norcross, GA, USA) following the manufacturer’s instruction. Two µg of the purified RNA was reverse transcribed using HiScript II First Strand cDNA Synthesis kit (Vazyme, Nanjing, China) according to the manufacturer’s instruction. The mRNA level of IDH1 was determined by quantitative real-time PCR analysis using qPCR SYBR Green Master mix (Vazyme) which was normalized to 18S RNA as the internal control. IDH1 primer: GACTCAGTCGCCCAAGGT (Sense), GCAGCCTCTGCTTCTACC (Antisense); Nrf2 primer: TGGACGGGACTATTGAAGGCTG (Sense), GCCGCCTTTTCAGTAGATGGAGG (Antisense); 18S RNA primer: CTCAACACGGGAAACCTCAC (Sense), CGCTCCACCAACTAAGAACG (Antisense). Each sample was analyzed in triplicate, and the expression levels were normalized using the 2−ΔΔCt -based fold change method.
4
Expression Patterns of OsMOT1;2 in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To study the expression pattern of OsMOT1;2 during the whole growth period of rice, different tissues and organs of ZH11 were sampled at seedling, tillering, booting, flowering, and grain filling stages. To investigate the expression pattern of OsMOT1;2 under various nutrient-deficient conditions, 1-week-old ZH11 seedlings cultured with half-strength Kimura B nutrient solution were treated with indicated element omitted nutrient solution for another 1 week. Shoots and roots of the seedlings were harvested separately. Samples were frozen in liquid nitrogen and ground into powder using a grinder or mortar. RNA was extracted by a Universal Plant Total RNA Extraction Kit (BioTeke, Wuxi, China). After removing residual DNA contamination, RNA was reverse transcribed into cDNA using a HiScript II First-Strand cDNA Synthesis Kit (Vazyme, Nanjing, Jiangsu, China). qRT-PCR was performed to determine the relative expression level using 2 × AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, Jiangsu, China).
5
Evaluating Nodulation Candidate Genes via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify whether the candidate genes were involved in nodulation, total RNA was extracted with a total RNA extraction reagent (Transgene Biotech Co, Beijing, China). First-strand cDNA was synthesized by reverse transcription with the HiScript® II First-strand cDNA Synthesis Kit (Vazyme Biotech, Nanjing, China). The qRT-PCR assay was completed with the Roche LightCycler 480 quantitative PCR instrument. The qRT-PCR primers were designed based on the locus information in Phytozome, and GmUKN1 (Glyma.12G020500) was used as a reference gene for normalizing the target gene expression levels (Hu et al., 2009 (link)). The qRT-PCR program was as follows: pre-denaturation at 95°C for 30 s and then 40 cycles of release and an annealing temperature of 58°C for 10 s. The qRT-PCR assay was completed with three biological replicates, each comprising three technical replicates, to increase the accuracy of the data.
6
Evaluating Antibacterial Mechanisms of TF1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To further explore the underlying mechanism of the antibacterial activity of TF1, the RNA expression of cell division and virulent-related genes of SC19 was evaluated. Briefly, SC19 was grown to the mid-log phase. Then, TF1 was added at 512 μg/mL and cocultured at 37 °C for 4 h. Total RNA was reverse transcribed using the HiScript II First-Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) following the recommended protocol. Primers were listed in Table 4 . The 16S rRNA gene was chosen as the internal control. Fold change >2 and p < 0.05 were used to represent up- or downregulation.
7
Quantifying Gene Expression in Soybean Seedlings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of samples was extracted from plant seedlings using Trizol solution (Vazyme Biotech Co., Ltd., Nanjing, China). The complementary DNA (cDNA) templates were synthesized using the HiScriptII first strand cDNA synthesis kit (Vazyme Biotech Co., Ltd., Nanjing, China) [58 (link)]. Using SYBR PremixEx-TaqTMII (Takara Bio Inc., Kusatsu, Japan), the RNA transcripts of the relative genes were measured using a real-time CFX96TM system (Bio-Rad, Hercules, CA, USA) for qRT-PCR [51 ]. The following procedure was performed for qRT-PCR: 94 ◦C for 3 min; 39 cycles of denaturation at 94 ◦C for 10 s, annealing at 57 ◦C for 10 s, elongation at 72 ◦C for 30 s. The reference gene was Actin-3 in soybean. Finally, the relative expression values were calculated using the comparative cycle threshold method 2−△△ct. The experiments were carried out with three independent organisms [25 (link)].
8
Actinomycin D Stability of circ_0006789
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
By adding 2 mg/ml actinomycin D (Sigma-Aldrich), HeLa and Siha cells were incubated at 37 °C for 4, 8, 12, and 24 h. Extracted RNA was collected using HiScript II first strand cDNA synthesis kit (Vazyme, Nanjing, China) to determine the stability of circ_0006789 using PCR.
9
Quantifying TLR4 mRNA Expression using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following transfection for 48 h, cells were collected and washed with PBS twice. Next, based on the one-step method (20 (link)), total RNA was extracted by adding 1 ml RNA isolator (Vazyme Biotech Co., Ltd.). As the template for PCR, cDNA was synthesized using the HiScript II First Strand cDNA Synthesis kit according to the manufacturer's protocol (Vazyme Biotech Co., Ltd.). The internal reference was human GAPDH. The fluorescent signal was obtained using SYBR-Green I. Based on the manufacturer's protocol of the qPCR SYBR-Green Master Mix kit (Vazyme Biotech Co., Ltd.), qPCR was performed. The thermocycling conditions were as follows: 95°C for 5 min (pre-denaturation), followed by 40 cycles at 95°C for 10 sec and 60°C for 30 sec, and dissociation at 95°C for 15 sec, 60°C for 1 min and 95°C for 15 sec. For each sample, each experiment was repeated three times. The forward primer for GAPDH was 3′-CACTACCGTACCTGACACCA-5′ and the reverse primer was 3′-ATGTCGTTGTCCCACCACCT-5′. The TLR4 sequence was synthesized by GeneCopoeia, Inc. (cat. no. HQP054754). The relative expression levels of TLR4 mRNA (ΔCq=CqTLR4-CqGAPDH) were calculated using the 2−ΔΔCq method (21 (link)). RT-qPCR was used to evaluate the silencing effect of shRNA TLR4 expression levels and to select the interference plasmid with the greatest silencing effect.
10
Hippocampal RNA Extraction and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, the total RNA of tissues was isolated from hippocampal tissues using the miRNeasy Micro Kit (QIAGEN, 217084) according to the manufacturer’s protocol and then reverse-transcribed into complementary DNA (cDNA) using the HiScript II First Strand cDNA Synthesis Kit (Vazyme, Nanjing). Specific primer sequences were used for the amplification of NHE1 (forward primer: 5′-CTGCAGTCGGACGTCTTCTT-3′; reverse primer: 5′-GTTCTCCGTGAACTGCCTCA-3′), CUL4A (forward primer: 5′-AAAATGGCCA CCGGCATAGA-3′; reverse primer: 5′- CACCTCCTTCCCTTTGGGAC-3′), and GAPDH (forward primer: 5′-TCTCTGCTCCTCCCTGTTC-3′; reverse primer: 5′-ACACCGACCTTCACCATCT-3′). Bio-Rad’s IQ5 software was used to analyze the polymerase chain reaction data, and quantified mRNA data were normalized to GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!