Cells were treated with doxycycline (Sigma-Aldrich, #D9891, 200 ng/ml) for 72 h. Total RNA was isolated using SuperPrep Cell Lysis kit (TOYOBO, #SCQ-101) as described by manufacturer and reverse transcribed with SuperPrep RT kit for qPCR (TOYOBO, #SCQ-101) for cDNA synthesis. Target genes were detected by real time PCR in CFX96 Touch™ according to manufacturer's protocol. Transcripts were quantified relative to the housekeeping gene, GAPDH. The probes used for this study were listed in Table S7 .
Superprep cell lysis kit
Manufactured by Toyobo
Sourced in Germany, Japan
The SuperPrep Cell Lysis Kit is a laboratory reagent designed to efficiently lyse cells and extract cellular contents for further analysis. The kit utilizes a proprietary lysis buffer and protocol to release proteins, nucleic acids, and other biomolecules from a variety of cell types.
Automatically generated - may contain errors
Lab products found in correlation
Superprep rt kit for qpcr, by Toyobo (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Superprep rt kit, by Toyobo (2 mentions)
Kod sybr qpcr mix, by Toyobo (2 mentions)
Thunderbird sybr qpcr mix, by Toyobo (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Doxycycline, by Merck Group (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Abi 7300 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green 1 master mix, by Roche (1 mentions)
Sybr green 2, by Takara Bio (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Stratagene mx3000p, by Agilent Technologies (1 mentions)
Gdna remover kit, by Toyobo (1 mentions)
Lightcycler 480, by Roche (1 mentions)
9 protocols using superprep cell lysis kit
1
Doxycycline-Induced Gene Expression
2
Isolation and Analysis of Bone Cell RNAs
3
Pomalidomide Regulation of ZMYM2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To show that pomalidomide-dependent protein degradation of ZMYM2 is downregulated at the post-translational level, ZMYM2 mRNA expression in HEK293T or IMR32 cells treated with pomalidomide or DMSO (0.1%) for 24 h was examined by qRT-PCR. Total RNA was isolated from the cells using the SuperPrep Cell Lysis Kit (Toyobo) and cDNA was synthesised using the SuperPrep RT kit (Toyobo), according to the manufacturer’s protocol. RT-PCR was performed using KOD SYBR qPCR Mix (Toyobo) and the data were normalised against GAPDH mRNA levels. PCR primers were as follows: ZMYM2 sense 5′-CTAACTGAGATTCGCCATGAAGTC-3′, ZMYM2 antisense 5′-CTCTCCACACTGTTCACAGCAATTC-3′, GAPDH sense 5′-AGCAACAGGGTGGTGGAC-3′, and GAPDH antisense 5′-GTGTGGTGGGGGACTGAG-3′.
4
Evaluating PLZF and SALL4 mRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To demonstrate decreased post‐translational level of PLZF protein, PLZF mRNA expression in HEK293T, HuH7 or THP‐1 cells treated with DMSO or lenalidomide for 24 h was assessed by qRT–PCR. To analyse SALL4 or PLZF mRNA expression, HuH7 cells treated with DMSO, thalidomide or 5‐hydroxythalidomide for 24 h were assessed by qRT–PCR. Total RNA was isolated from HEK293T, HuH7 or THP‐1 cells treated with DMSO or lenalidomide for 24 h using a SuperPrep cell lysis kit (Toyobo). cDNA was synthesised using a SuperPrep RT kit (Toyobo) according to the manufacturer's protocol. RT–PCR was performed using a KOD SYBR qPCR Mix (Toyobo), and data were normalised against glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) mRNA levels. PCR primers were as follows: PLZF FW 5′‐GCACAGTTTTCGAAGGAGGA‐3′, PLZF RV 5′‐GGCCATGTCAGTGCCAGT‐3′, SALL4 FW 5′‐GGTCCTCGAGCAGATCTTGT‐3′, SALL4 RV 5′‐GGCATCCAGAGACAGACCTT‐3′, GAPDH FW 5′‐AGCAACAGGGTGGTGGAC‐3′, GAPDH RV 5′‐GTGTGGTGGGGGACTGAG‐3′.
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNAs were extracted from HaCaT or A431 cells using SuperPrep Cell Lysis Kit (Toyobo Life Science) following the manufacturer's protocol. QRT-PCR was performed using the primers (as specified in supplemental Table S2 ) in a 20-µL reaction volume in SYBR Green I Master Mix (Roche) on an ABI StepOne plus QPCR System. GAPDH mRNA was used as an internal control, which was quantified in parallel with mRNAs of the target genes. Normalization and fold changes were calculated by the ΔΔCt method.
6
Quantitative RT-PCR Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA samples for quantitative RT‐PCR were prepared by SuperPrep Cell Lysis Kit instructions attached to the kit (Toyobo, Osaka, Japan). cDNA was used as template for quantitative PCR analysis, using SYBR Green II (TAKARA, Kusatsu, Japan) and StepONE plus (Thermo Fisher Scientific). To perform relative quantification, the comparative threshold (Ct) cycle method was used. GAPDH was used as housekeeping control gene to normalize target genes. The fold change in gene expression profile was referred to iPSCs sample. Primer sequences (5′–3′) for amplification of qPCR were the following: NANOG‐Fw GATTTGTGGGCCTGAAGAAA, NANOG‐Rv CTTTGGGACTGGTGGAAGAA; PAX6‐Fw AGTTCTTCGCAACCTGGCTA, Pax6‐Rv ATTCTCTCCCCCTCCTTCCT; NESTIN‐Fw TCCAGGAACGGAAAATCAAG, NESTIN‐RV GCCTCCTCATCCCCTACTTC; MAP2‐Fw CAGCAGGTGGGGAATCAG, MAP2‐Rv GCAGGAATCTTTGACAAGGTAGA; S100B‐Fw GGAAGGGGTGAGACAAGGA, S100B‐Rv GGTGGAAAACGTCGATGAG; GFAP‐Fw GTCTGTGTCAGAAGGCCACC, GFAP‐Rv GTGCTCCTGCTTGGACTCC.
7
Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy Mini kit (Qiagen, Hilden, Germany) or SuperPrep Cell Lysis Kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. Samples were analysed for RNA content using a Nanodrop spectrophotometer (Thermo Fisher Scientific). cDNA was synthesized from 1 μg of RNA using the ReverTra Ace (Toyobo). Quantitative PCRs were carried out with SYBR Premix Ex Taq (Takara, Kusatsu, Japan) and the StepOnePlus Real Time PCR System (Thermo Fisher Scientific). The data were assessed using the 2-ΔΔCt method and normalized by GAPDH expression. Primer sequences are described in Supplementary Material, Table S2 .
8
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NMP-R mESCs were transfected with sgRNA expression vectors and treated as described above. Cells were then transferred onto 96-well plates, 6 h before RNA extraction. Total RNA was isolated from cells using a SuperPrep Cell Lysis Kit (Toyobo, Osaka, Japan) for quantitative PCR (qPCR) and for reverse transcription (RT)-PCR according to the manufacturer's protocol. Total RNA was converted to cDNA using a SuperPrep RT Kit for qPCR (Toyobo). qPCR was performed with the Stratagene Mx3000p (Agilent Technologies, Palo Alto, CA, USA) using the THUNDERBIRD SYBR qPCR Mix (Toyobo). The threshold cycle (Ct) value was normalized with the housekeeping gene Gapdh and the relative fold change was computed by the ΔΔCt method (22 (link)). Primer sequences are listed in Supplementary Table S2.
9
Quantitative PCR Analysis of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were prepared as described above or using the SuperPrep Cell Lysis Kit for quantitative PCR (qPCR) (Toyobo Co., Ltd., Osaka, Japan). For cDNA synthesis, we used the RT Kit (Toyobo) optimized for lysate by the SuperPrep Cell Lysis Kit or we used ReverTra Ace qPCR RT Master Mix with the gDNA Remover kit (Toyobo). For real-time qPCR, THUNDERBIRD SYBR qPCR Mix (Toyobo) was used. Primers used for qPCR are listed in Supplementary Table 1. LightCycler 480 (Roche Diagnostics, Basel, Switzerland) was used for real-time PCR. Each Crossing Point was determined using the second derivative maximum method, and the Pfaffl method was used for relative quantification (Pfaffl, 2001) . For the quantification, we used the β-actin gene as a housekeeping gene for reference.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!