Polyethylenimine (pei)

The Tet-O-FW GFP/miR-218-5p (indicated as miR-218-5p in the graphs and the pictures of the different figures) construct generation is described in ref. [19 ] and was transfected in combination with the plasmid encoded for the rtTA transactivator. An empty Tet-O-FW GFP vector (kind gift of dr. GianCarlo Bellenchi, IGB-CNR) was used as control. Transient transfections in MCF7 and MDA-MB-231 cells were performed using polyethylenimine (PEI, Tebu-Bio, Le Perray-en-Yvelines, France, 23966-1). Other plasmids used in this study are vectors encoded for GFP-Parkin and ShortHairpin(sh)-Parkin/GFP. A vector encoding for GFP alone was used as a control.

Transient knocking down of ATM, CHK1, CHK2, GSNOR, Parkin, and p53 was performed by transfecting cells with commercially available endoribonuclease‐prepared siRNA pool (esiRNA, Sigma‐Aldrich), while controls were transfected with a scramble siRNA duplex (siScr), which does not present homology with any other human mRNAs. siRNAs were transfected using Lipofectamine 3000 (Thermo Fisher Scientific), according to manufacturer’s instructions. Overexpression of GSNOR and p53^wt was performed using PEI (Tebu‐bio).
shRNA used to stably knockdown ATM was designed in our laboratory and synthesized by TAG Copenhagen.

Top	5'‐TGCTGCTTTTATGAGCACCATCTTCAGTTTTGGCCACTGACTGACTGAAGATTGCTCATAAAAG‐3'
Bottom	5'‐CCTGCTTTTATGAGCAATCTTCAGTCAGTCAGTGGCCAAAACTGAAGATGGTGCTCATAAAAGC‐3'

Constructs were cloned in pcDNA6.2‐GW/EmGFP‐miR vector using the BLOCK‐iT™ Pol II miR RNAi Expression Vector Kit with EmGFP (Thermo Fisher Scientific), in according to manufacturer’s instructions, and were transfected using Genejuice (Merck).

U87MG and T98G (originally obtained by ATCC) were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin (Sigma-Alrich). GBMSC83 cells, a well-characterized mesenchymal GBM cellular model, were cultured as neurospheres in non-adherent conditions in DMEM/F12 supplemented by B27 Supplement (50x), EGF (20 ng/ml), and hβFGF (10 ng/ml) as previously described (Mao et al, 2013 (link); Minata et al, 2019 (link)). All GBM cells were maintained in a humidified 5% CO, 37°C incubator and were routinely tested negative for mycoplasma contamination.
Stable cell lines, overexpressing Src wild-type or catalytically inactive mutant kinase dead in p-MX-psCESAR vector, were generated by retroviral infection followed by cell sorting for GFP⁺ cells. For transient transfection experiments, cells were seeded the day before and transfected using polyethylenimine (PEI) (Tebu-Bio), following the manufacturer’s instructions. Src constructs pSGT-Src-Y527F and pSGT-K295M and empty pSGT vector were previously described (Cursi et al, 2006 (link)). pCDNA3.1-FLAG-NRF2^WT was obtained from Addgene.