Abi prism 7500 fast system

Total RNA was extracted from cells or livers using the High Pure RNA Isolation kit (Roche) or the NZY Total RNA Isolation Kit (NZYTech), respectively, according to the manufacturers´ instructions. Complementary DNA (cDNA) was synthesized from 1 μg of RNA using the Roche cDNA synthesis kit, according to the manufacturer’s instructions. The qPCR reaction was performed in a total volume of 20 µL in a ABI Prism 7500 Fast system (Applied Biosystems) using the iTaq^TM Universal SYBR® Green kit (BioRad). Parasite load was quantified using primers specific to P. berghei 18S RNA (see Supplementary Table 1). Human or mouse housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT or Hprt, respectively) expression was used for normalization (see Supplementary Table 1). Analysis of qPCR data was performed using the delta-delta CT relative quantification method.

The relative mRNA expression levels of PmHsc70, PmHsp70a, and PmHsp70b in SD, WD, and ND groups in P. melete were analyzed using real-time fluorescence quantification PCR (qRT-PCR). The procedure included high-quality RNA extraction using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), cDNA synthesis using the SuperScript III Reverse Transcriptase reagent test kit (Invitrogen, Carlsbad, CA, USA), and an oligo(dT) primer. The gene-specific primers for qRT-PCR were designed by Primer 3 (Table S1). β-actin (KU527138) and 18S ribosomal RNA (KU527139) were used as internal normalized genes. The qRT-PCR was performed using ABI Prism 7500 Fast System (Applied Biosystems, Foster, CA, USA) and reagent test kit from TIANGEN (SYBR Green SuperReal PreMix Plus, Beijing, China). Amplifications were carried out under the following conditions, initial denaturation at 95 °C for 10 min followed by 40 cycles of 5 s at 95 °C and for 30 s at 60 °C, followed by a melting curve stage (60–95 °C) to confirm gene-specific amplification. The amount of cDNA was determined using the 2^−ΔΔCT quantification method. The experiment was conducted with three biological treatments and three technical replicates.

Quantitative PCR (qPCR, ABI Prism 7500 Fast System, Applied BioSystems, Warrington, UK) was used to validate the most responsive transcripts by means of TaqMan^® and SYBR™ Green assays. The resultant data were then analysed further for functional enrichment using annotation software. Relative gene expression was calculated using the 2^{− ΔΔCT} method, and the resultant C_T values normalized to the invariant house-keeping gene rla-1.^{31 (link)} Data were expressed as mean ± standard error of the mean (SEM), N = 3 biological replicates per condition.

Liver lobes collected for qPCR analysis were homogenized in 3 mL of denaturing solution (4 M guanidine thiocyanate; 25 mM sodium citrate pH 7; 0.5% w/v N-lauroylsarcosine and 0.7% v/v β-mercaptoethanol in DEPC-treated water). Total RNA was extracted from liver homogenates using the Qiagen RNA extraction kit, according to the manufacturer’s instructions. The concentration of RNA in each sample was assessed by measurement of absorbance at 260 nm on a NanoDrop 2000 spectrophotometer. Complementary DNA (cDNA) was synthesized from 1 μg of RNA using the NZYTech First-Strand cDNA synthesis kit, according to the manufacturer’s instructions. The cDNA was synthesized in a Biometra Personal thermocycler employing the following parameters: 25 °C for 10 min, 55 °C for 30 min and 85 °C for 5 min. The qPCR reaction was performed in a total volume of 20 μL in an ABI Prism 7500 Fast system (Applied Biosystems) using the SYBR® Green Real-Time PCR Master Mix (BioRad). Parasite load was quantified using primers specific to Pb 18 S rRNA (forward/reverse: AAGCATTAAATAAAGCGAATACATCCTTAC/ GGAGATTGGTTTTGACGTTTATGTG). Mouse housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt) expression was used for normalization (forward/reverse: TTTGCTGACCTGCTGGATTAC/ CAAGACATTCTTTCCAGTTAAAGTTG). Analysis of qPCR data was performed using the delta-delta relative quantification method.

To analyze the gene expression of inflammatory cytokines and complement components in gingival tissues, brain tissues, or cultured microglia cells, tissues or cells were homogenized and total RNA were extracted using Direct-zol RNA Miniprep kit (ZYMO Research, #R2052). cDNA was synthesized using a PrimeScript RT Reagent kit (Takara, #RR037) using equal amount of RNA. RT-qPCR was performed using an ABI Prism 7500 fast system (Applied Biosystems) with the 2x qPCR Master Mix (NEB, #M3003). All primers information is listed in Table S1.