Puc57 sgrna

Animals were applied to experiments with the approval of the Ethics Committee of Shengjing Hospital of China Medical University (NO. 2022PS458K). Animal experiments in this study were performed according to the Guide for the Care and Use of Laboratory Animals.
Production of DEF6-knockout (KO) mice: An online CRISPR design tool (http://chopchop.cbu.uib.no/) was utilized to design guiding sequences targeting the second exon of the mouse DEF6 gene (guideRNA1 target site: GGACACCGGGCCATCATCGTCATCC-CGG), and pUC57-sgRNA (Addgene, 51132) was used to generate the DEF6-sgRNA expression vector. The in vitro transcription products of the DEF6-sgRNA expression vector and Cas9 expression vector pST1374-CAS9 (Addgene, 44758) were purified and mixed. In the next step, fertilized eggs collected from C57BL/6 mice were microinjected with this mixture using a FemtoJet 5247 microinjection system and subsequently transplanted into pseudopregnant foster mothers' oviducts. After 19-21 days, F0-generation mice were born. Two weeks later, genomic samples were obtained from the toes of F0 mice, and the genotypes were tested using the following pair of primers: F : 5′-CCGGATGCAGAAAAGCAACC-3′, R : 5′-CGCGGGAGCTAAGAGAGATG-3′.

All animal use protocols were approved by Zhengzhou University. The procedures were in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.
In order to obtain RNF5 knockout mice, we used the CRISPR online design tool (http://chopchop.cbu.uib.no/) to predict target DNA regions boot sequence-guideRNA target site: GCCCCGCTCGCGATTTGGCCCTTCGGG, RNF5-sgRNA expression vector was constructed using pUC57-sgRNA (Addgene,51132) as skeleton vector. The in vitro transcripts of Cas9 expression vector pST1374-Cas9 (Addgene 44758) and sgRNA expression vector were purified, recovered, and configured into a mixed system (Cas9 mRNA: 10 ng/ul;sgRNA: 10 ng/ul), the mixture was injected into single-cell fertilized eggs of C57BL/6 mice by FemtoJet 5247 microinjection system, and the injected fertilized eggs were transplanted into surrogate female mice, and F0 generation mice were obtained after about 19–21 days of gestation. The ear tissues of mice 2 weeks after birth were collected, genomic DNA was extracted, and the following primers were used to identify the genotypes of mice: RNF5-Check F1: 5′ -CTGGGGGTACTGAGGGCTAC-3′, RNF5-check R1:5′-GCCCTCTGGTCATCTGAAAA-3′. The selected Founder was then multiplied and constructed until RNF5-/- mice were obtained for subsequent experiments.

The CRISPR online design tool (http://chopchop.cbu.uib.no/) was used to predict the guiding sequence as follows: guideRNA1 target site: 5′-GCCTGAGTGAGCCAGGCGCGATGGG-3′, guideRNA2 target site: 5′-TTGGGGCACGGTGACTTTCCGGAGG-3′, which resulted in a 2 kb deletion in total. The GALNT4-sgRNA expression vector was constructed on the BsaI restriction site of pUC57-sgRNA (Addgene, 51132). The products of the Cas9 expression vector pST1374-Cas9 (Addgene 44758) and the sgRNA expression vector were mixed and microinjected into C57BL/6J zygotes with the FemtoJet 5247 microinjection system. F0 generation mice were obtained after 19–21 days, and were identified by PCR and sequencing DNA was extracted from the ear tissue of 2-week-old mice and assessed using the primers below: GALNT4-check F1: 5′-AAGGTCACAAAGCTGCCATC-3′, GALNT4-check R1: 5′- GGAGGTGCAATCGACCTTTA-3′.