The effect of in vitro acetylation on bacterial protein synthesis was investigated in the Expressway cell-free E. coli expression system (Invitrogen). The green fluorescent protein (GFP) gene was amplified from the pCmGFP plasmid (47 (link)) and inserted into pEXP5-CT TOPO (Thermo Fisher Scientific), and the resulting plasmid was used as a template for in vitro transcription and translation (IVTT). Reactions were performed according to the manufacturer’s protocol, in 50 μL of reaction mixture, in the wells of a black polystyrene 96-half-well microplate (Greiner). Feed buffer was added after 30 min of incubation, to ensure optimal protein synthesis. Reactions were initiated by adding 1 μg of plasmid DNA. The plate was incubated at 30°C and fluorescence was measured every 20 min (λex = 475 nm; λem = 520 nm) with a Spark M10 microplate reader (Tecan). Fluorescence from GFP synthesis was recorded at 20 min after addition of feed buffer using GraphPad Prism 6 software. Gentamicin was used as positive control at 10 μM.
Expressway cell free e coli expression system
Manufactured by Thermo Fisher Scientific
Sourced in United States, France
The Expressway cell-free E. coli expression system is a laboratory equipment used for the rapid and efficient expression of recombinant proteins. It utilizes an E. coli-based cell-free transcription and translation system to produce proteins without the need for cell culturing.
Automatically generated - may contain errors
6 protocols using expressway cell free e coli expression system
1
In vitro Acetylation Effect on Bacterial Protein Synthesis
2
Purification of His6-tagged WISP1, GST, and GST-Siah-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro protein synthesis of His6-tagged WISP1, GST and GST-Siah-1 fusion protein was performed using Expressway cell-free E. coli expression system (Invitrogen, Waltham, CA, United States), followed by purification of His6-tagged WISP1 using Ni-NTA magnetic agarose beads (Qiagen, München, Germany) and of GST and GST-Siah-1 using glutathione-Sepharose 4FF (GE Healthcare, Piscataway, NJ, United States). The eluted proteins were analyzed by immunoblot as previously described.
3
MSBI1 Recombinant Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
MSBI1 Rep Protein Purification
A nucleotide acid molecule encoding full-length Rep open reading frame (ORF) identified within the MSBI1 genome is cloned into an expression plasmid (pEXP5-CT, Invitrogen) enabling protein expression based on an E. coli high yield cell free in vitro translation system (Expressway™ Cell-Free E. coli Expression System, Invitrogen). The synthesized Rep protein having the amino acid sequence of SEQ ID NO:1 within the in vitro translation reaction is denaturated by adding 20 reaction volumes 8 M urea sample buffer pH 8.0 containing 100 mM NaH2PO4, 10 mM Tris HCl, pH 8.0, 5 mM imidazole. The Rep protein is subsequently purified under denaturating conditions (20 mM imidazole for washing and 300 mM imidazole for protein elution) based on a C-terminal His6-tag fused to the Rep protein. Quality of purification is determined by Coomassie protein staining and Western Blotting with anti-Rep protein antibodies. The Rep protein purity is densitometrically calculated and greater 95%. The purified protein is either directly used for ELISA-based serum screening or subjected to SDS-Page followed by transfer blotting onto nitrocellulose membranes for serum incubation of 1D-size-resolved Rep protein membrane stripes.
4
Recombinant Rep Protein Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
A nucleotide acid molecule encoding full-length Rep open reading frame (ORF) identified within the MSBI1 genome is cloned into an expression plasmid (pEXP5-CT, Invitrogen) enabling protein expression based on an E. coli high yield cell free in vitro translation system (Expressway™ Cell-Free E. coli Expression System, Invitrogen). The synthesized Rep protein having the amino acid sequence of SEQ ID NO:1 within the in vitro translation reaction is denaturated by adding 20 reaction volumes 8 M urea sample buffer pH 8.0 containing 100 mM NaH2PO4, 10 mM Tris HCl, pH 8.0, 5 mM imidazole. The Rep protein is subsequently purified under denaturating conditions (20 mM imidazole for washing and 300 mM imidazole for protein elution) based on a C-terminal His6-tag fused to the Rep protein. Quality of purification is determined by Coomassie protein staining and Western Blotting with anti-Rep protein antibodies. The Rep protein purity is densitometrically calculated and greater 95%. The purified protein is either directly used for ELISA-based serum screening or subjected to SDS-Page followed by transfer blotting onto nitrocellulose membranes for serum incubation of 1D-size-resolved Rep protein membrane stripes.
5
Expression and Purification of InlJ Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
InlJ protein was expressed as a His-tagged fusion protein using an Expressway cell-free E. coli expression system (Invitrogen, Carlsbad, CA). Briefly, the entire coding region of inlJ (PGN_1611) was amplified from a P. gingivalis 33277 genomic template using primers F1 (ATGAAAAGAAAACCGCTATTCTCAG) and R1 (TTACGGCATCGCGGTTTTGATCG), cloned into pEXP5-NT/TOPO, and transformed into E. coli TOP10 cells. Following confirmation by sequencing, soluble His-tagged protein was obtained using MagneHis particles (GE Healthcare, Pittsburgh, PA). The purity of the resulting protein was verified by SDS-PAGE electrophoresis.
6
Tetracycline Derivatives' Effect on Bacterial Protein Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The effect of the selected tetracycline derivatives (i.e., 3c , 3j , and 3u ) on in vitro bacterial protein synthesis was tested using the Expressway Cell-Free E. coli Expression System (Invitrogen for Thermo Fisher Scientific, Illkirch-Graffenstaden, France). pEXP5-CT TOPO-GFP was used as a template for in vitro transcription–translation. The reactions were performed following the manufacturer’s instructions and carried out in 50 µL including the addition of feed buffer at 30 min of incubation to support optimal protein synthesis. Reactions were initiated with 1 µg of plasmid DNA; mixtures were incubated at 30 °C with shaking (300 rpm), and fluorescence was measured after 3 h with a TECAN Spark microplate reader (λex = 475 nm; λem = 520 nm). IC50 values were calculated using GraphPad Prism 6 software. Independent experiments were performed at least three times, and the results are shown as the means of the replicates ± SD.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!