siRNA treatment was performed with siRNA (Invitrogen) against mouse TLR3: CCUGAUGAUCUUCCCUCUAACAUAA; UUAUGUUAGAGGGAAGAUCAUCAGG ; TLR7: GCUGCAGGUCAUCCAUGCAUCUAUA ; UAUAGAUGCAUGGUAGACCUGCAGC ; TLR9: CCAACAUCCUGGUUCUAGAUGCUAA ; UUAGCAUCUAGAACCAGGAUGUUGG or control siRNA (Qiagen). siRNAs (1.5 μg) were nucleofected into Raw264.7 cells with 90 μL of Nucleofector solution kit V (Amaxa, London, UK) (46 (link)). After transfection, the cells were transferred into a new flask containing 10 mL complete media and incubated at 37°C followed by a medium change at 6 h after incubation. The cells were then used in assays after 48 h of transfection with siRNAs.
Nucleofector solution kit 5
Manufactured by Lonza
Sourced in United Kingdom
The Nucleofector solution kit V is a laboratory equipment product designed for the transfection of various cell types. It provides the necessary solutions and buffers to facilitate the electroporation-based delivery of genetic material into cells.
Automatically generated - may contain errors
6 protocols using nucleofector solution kit 5
1
siRNA Knockdown of TLR3, TLR7, and TLR9
2
Genetic Constructs and Transfection Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IRGM constructs were described previously 4 (link), 12 (link)–14 (link). Stx17
construct was a kind gift from N. Mizushima. MiTF and TFE3 constructs were from
R.Perera. TFEB constructs were kindly provided by R. Puertollano. Plasmid
constructs were verified by DNA-sequencing. Plasmids were transfected using
ProFection Mammalian Transfection System from Promega or Lipofectamine 2000
reagent from Thermo Fisher. All siRNAs were from Dharmacon. Cells were
transfected with 1.5 μg of siRNAs. For siRNA transfections 106cells were resuspended in 100 μl of Nucleofector solution kit V (Amaxa),
siRNAs were then added to the cell suspension and cells were nucleoporated using
Amaxa Nucleofector apparatus with program D-032. Cells were re-transfected with
a second dose of siRNAs 24 h after the first transfection and assayed after 48
h. miRNA196 (sequence: UAGGUAGUUUCCUGUUGUUGGG) and miRNA20 (sequence:
UAAAGUGCUUAUAGUGCAGGUAG) were transfected with lipofectamine 2000 reagent. Cells
were assayed 48h after transfection.
construct was a kind gift from N. Mizushima. MiTF and TFE3 constructs were from
R.Perera. TFEB constructs were kindly provided by R. Puertollano. Plasmid
constructs were verified by DNA-sequencing. Plasmids were transfected using
ProFection Mammalian Transfection System from Promega or Lipofectamine 2000
reagent from Thermo Fisher. All siRNAs were from Dharmacon. Cells were
transfected with 1.5 μg of siRNAs. For siRNA transfections 106cells were resuspended in 100 μl of Nucleofector solution kit V (Amaxa),
siRNAs were then added to the cell suspension and cells were nucleoporated using
Amaxa Nucleofector apparatus with program D-032. Cells were re-transfected with
a second dose of siRNAs 24 h after the first transfection and assayed after 48
h. miRNA196 (sequence: UAGGUAGUUUCCUGUUGUUGGG) and miRNA20 (sequence:
UAAAGUGCUUAUAGUGCAGGUAG) were transfected with lipofectamine 2000 reagent. Cells
were assayed 48h after transfection.
3
Genetic Constructs and Transfection Protocols
4
Transfection of Telomerase Components
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cen3tel PD643 NT and TERC KO clones were transfected with 2 μg empty vector (pcDNA3.1+) or hTR-expressing plasmid (pBS-U1-hTR). A pellet of 1×106 cells was resuspended in 100 μL Lonza’s Nucleofector Solution Kit V and electroporated in an Amaxa electroporator on setting D-032. Transfected cells were then transferred to a 6-well plate, media was replaced with fresh media 24 hr later, and cells were collected an additional 24 hr later (48 hrs after electroporation) to assess hTR expression, telomerase activity, and/or C-circle signal.
5
TERC Knockout via CRISPR-Cas9 RNP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TERC was knocked out via RNP electroporation of Cas9 protein with two guide RNAs. The guides were designed by Horizon’s CRISPR Design Tool, where crRNA is the target and tracrRNA (cat. #: U-0020005-05) is the scaffold. The catalogue numbers for the TERC guides are as follows: crRNA-539475:WCEFR-000001 and crRNA-539476:WCEFR-000002. A nontargeting crRNA was also used as a negative control in each experiment (cat #: U-007501-01-05). To prepare the RNP, 1 μl of 200 μM crRNA was mixed with 1 μl of 200 μM tracrRNA. Then 1.6 μl 10 mg/ml Cas9 protein (IDT cat. #: 1081059) was added to that mixture and incubated at room temperature for 10 to 15 min. This mixture was resuspended with 1 × 106 cells in 100 μl of Lonza’s Nucleofector Solution Kit V and electroporated in an Amaxa electroporator on setting D-032. Cell mixtures were then transferred to a 6-well plate and allowed to recover 24 to 48 h before assessing their genotypes.
6
Telomerase Activity in Knockout Clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cen3tel PD643 NT and TERC KO clones were transfected with 2 μg empty vector (pcDNA3.1+) or hTR-expressing plasmid (pBS-U1-hTR). A pellet of 1 × 106 cells was resuspended in 100 μl Lonza’s Nucleofector Solution Kit V and electroporated in an Amaxa electroporator on setting D-032. Transfected cells were then transferred to a 6-well plate, media was replaced with fresh media 24 h later, and cells were collected an additional 24 h later (48 h after electroporation) to assess hTR expression, telomerase activity, and/or C-circle signal.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!