Log In Sign up
The largest database of trusted experimental protocols

Next ultra 2 dna library prep kit

Manufactured by New England Biolabs
Visit Supplier

The Next Ultra II DNA Library Prep Kit is a laboratory product designed for the preparation of DNA libraries for sequencing applications. It provides the necessary reagents and protocols to convert DNA samples into sequencing-ready libraries.

Automatically generated - may contain errors

Lab products found in correlation

Bioruptor, by Diagenode (1 mentions) Ab1220, by Abcam (1 mentions) Hiseq 4000 sequencer, by Illumina (1 mentions) Bioruptor pico, by Diagenode (1 mentions) Nucleospin kit, by Macherey-Nagel (1 mentions) Superscript 4, by Thermo Fisher Scientific (1 mentions) Cloneamp hifi, by Takara Bio (1 mentions) Bioruptor tubes, by Diagenode (1 mentions) Rna solv, by Omega Bio-Tek (1 mentions) Anti rabbit secondary antibody, by Thermo Fisher Scientific (1 mentions) Anti flag, by Merck Group (1 mentions) Anti ctcf, by Merck Group (1 mentions) Pag mnase, by EpiCypher (1 mentions) Anti runx1, by Santa Cruz Biotechnology (1 mentions) Dneasy powersoil kit, by Qiagen (1 mentions) Ampure xp, by Beckman Coulter (1 mentions) Bioanalyzer 2100 device, by Agilent Technologies (1 mentions)

Spelling variants of this product

Ultra II (3 citations)

5 protocols using next ultra 2 dna library prep kit

1

ChIP-seq Protocol with Chromatin Shearing

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP-seq were perfomed as described previously with some modifications55 (link). For the modified steps, the ground cells were further broken up by a dounce homogenizer, and Bioruptor (Diagenode) was used to shear chromatin. The antibody against H3K9me2 was obtained from Abcam (ab1220). ChIP-seq libraries were made by NEB Next Ultra II DNA Library Prep Kit. FASTQ files were quality-filtered using SICKLE, and mapping was performed using Bowtie256 (link). The files for data analysis (BEDGRAPH) were generated using samtools57 (link) and bedtools58 (link). Duplicate reads were kept as H3K9me2 is enriched at repetitive or multi-copy elements, but conclusions were unchanged regardless of removing duplicate reads. MACS259 was used for peak calling (q value = 0.01).
Shimada A., Cahn J., Ernst E., Lynn J., Grimanelli D., Henderson I., Kakutani T, & Martienssen R.A. (2023). Retrotransposon addiction promotes centromere function via epigenetically activated small RNAs. bioRxiv.
+ Open protocol
+ Expand
2

Viral Genome Sequencing by Amplicon Library

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using RNA-Solv (Omega Bio-tek), and reverse transcribed using Superscript IV (Thermo Fisher) and oligo (dT) as a primer, following the manufacturers’ instructions. Viral cDNA was PCR amplified using CloneAmp HiFi (TaKaRa) in four overlapping amplicons of about 2.2 kb, using the following primers:
For1, TGTACACACGGCTTTTAGGTAGA;
Rev1, GGAAAAGTGTTGCAAGAGCGA;
For2, TGTTCTTCGGGAAATGGGGA;
Rev2, TGCCTGTCCCACACGAATAG;
For3, GTTACGCGTGTCCTTTGACG;
Rev3, AACTTCCGTACCAACGCTCA;
For4, AAAGTTGCGTGGGTTTGTGG;
Rev4, CGTGTAAGCAGGGCAGATAGT.
Amplicons were purified with the NucleoSpin kit (MACHEREY-NAGEL), sheared in a Bioruptor Pico (Diagenode) by twelve cycles of 30 s of sonication and 30 s of cooling in 1.5 ml Bioruptor tubes (Diagenode), mixed in equimolar proportions, and used to prepare the library with the Next ultra II DNA library prep kit (E7645, NEB) using 1 μg of DNA per sample as input. Samples were multiplexed with barcodes (E7335, E7500, E7710, E7730, NEB), and the libraries were sequenced on an Illumina HiSeq 4000 sequencer as paired-end 100 base reads by the GenomEast platform, a member of the ‘France Genomique’ consortium. Image analysis and base calling were performed using RTA version 2.7.7 and bcl2fastq version 2.20.0.422.
Lezcano O.M., Fuhrmann L., Ramakrishnan G., Beerenwinkel N., Huynen M.A, & van Rij R.P. (2023). Parallel evolution and enhanced virulence upon in vivo passage of an RNA virus in Drosophila melanogaster. Virus Evolution, 9(2), vead074.
+ Open protocol
+ Expand
3

dTAG-47 Chromatin Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells at 5 ×105/mL were treated at indicated time points with 500nM dTAG-47. Cells were washed, attached to concanavalin A beads, permeabilized with digitonin and incubated overnight with anti-Flag (1:200, Sigma, F1804), anti-CTCF (1:100, Millipore, 07-729), anti-RUNX1 (1:100, SantaCruz, sc-365644), anti-H3K27me3 (1:100,CST, 9733), anti-H2AZ (1:100, ab4174), or anti-ETOZnf (1:100, made in house) at 4°C overnight. The next day cells were washed 3 times with PBS, then incubated with anti-mouse secondary antibody (1:200, abcam, ab46540) or anti-rabbit secondary antibody (1:200, Invitrogen, 31238) for 1.5 hours at 4°C as described54 (link). Beads were washed and incubated with pA/G-MNAse (Epicypher, 15-1116) for 10 min at 20° C and the MNase activated with 1mM CaCl2 for 2 hours at 4° C, before adding the Stop Buffer. Libraries were created with the NEB Next Ultra II DNA Library Prep Kit (NEB, E7645S) per the manufacturer’s protocol, amplifying for 14 cycles. The samples were sequenced by the VANTAGE Sequencing Core on the NovaSeq 6000 instrument.
Bomber M.L., Wang J., Liu Q., Barnett K.R., Layden H.M., Hodges E., Stengel K.R, & Hiebert S.W. (2023). Human SMARCA5 Is Continuously Required to Maintain Nucleosome Spacing. Molecular cell, 83(4), 507-522.e6.
+ Open protocol
+ Expand
4

Soil Eukaryotic Diversity Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Soil DNA was extracted using QIAGEN DNEasy PowerSoil Kit (0.25 g soil/tube) within 1 week after sampling, checking with PCR (primer pair C22FS-A1B2R, see Table S2) amplifying to ensure EDF existed in every site. The V4 region of the 18S rRNA gene was amplified using primer pair Ek-NSF573 - Ek-NSR951 (Mangot et al. 2013 (link)) with Vazyme 2 × Taq plus Master Mix and purified with Agencourt AMPure XP. The libraries were constructed with NEB Next Ultra II DNA Library Prep Kit. The amplicon libraries were qualified with Agilent 2100 and then sequenced with Illumina MiSeq (PE250). All the sequencing procedures would not stop until reaching at least 30,000 raw reads for each sample.
Yang J., Yun J., Liu X., Du W, & Xiang M. (2023). Niche and ecosystem preference of earliest diverging fungi in soils. Mycology, 14(3), 239-255.
+ Open protocol
+ Expand
5

Ultra-low DNA Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Because there was a small amount of template DNA (0.39 µg extracted from Caullerya spores harvested from 50 infected Daphnia: Supplementary Fig. S3), two library preparation methods were used that are optimised for ultra-low input DNA: Nextera (Illumina Nextera XT library prep kit) and NEBNext (New England BioLabs next ultra II DNA library prep kit).
Approximately 28 ng DNA was used for the preparation of Nextera libraries and 100 ng was used to prepare NEBNext libraries. Both were carried out according to the manufacturers' instructions. The quality and quantity of libraries were determined using a DNA Nano Chip assay on a 2100 Bioanalyzer device (Agilent Technologies) with a broad size distribution (300 -2000 bp; Supplementary Fig. S4). The Nextera library was sequenced three times and the NEBNext library was sequenced once on an Illumina MiSeq, in 150 bp paired-end (PE) mode (Supplementary Table S1).
Lu Y., Ocaña-Pallarès E., López-Escardó D., Dennis S.R., Monaghan M.T., Ruiz-Trillo I., Spaak P, & Wolinska J. (2020). Revisiting the phylogenetic position of Caullerya mesnili (Ichthyosporea), a common Daphnia parasite, based on 22 protein-coding genes. Molecular phylogenetics and evolution, 151.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!