From total RNA, cDNA was synthesized using iScript Reverse Transcriptase (BioRad, catalog #: 1708841). RT-qPCR assays were performed using SYBR Select Master Mix for CFX (Applied Biosystems) using Thermocycler C1000 CFX384 Real-Time System (BioRad). The primers used for amplification are listed in Supplementary Table 7 . Fold changes in transcript levels were calculated as lignan exposure relative to vehicle exposure using the ΔΔCT method.
Cfx384 real time system c1000 thermocycler
Manufactured by Bio-Rad
The CFX384 Real-time system C1000 Thermocycler is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It features a 384-well plate format and is capable of precise temperature control for DNA amplification and detection.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green supermix, by Bio-Rad (3 mentions)
Iscript reverse transcriptase, by Bio-Rad (2 mentions)
Sybr select master mix for cfx, by Thermo Fisher Scientific (2 mentions)
Nucleospin rna isolation kit, by Macherey-Nagel (2 mentions)
Random hexamer primer, by Promega (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Reverse transcriptase, by Vazyme (1 mentions)
Total rna extraction reagent, by Vazyme (1 mentions)
384 well pcr plate, by Bio-Rad (1 mentions)
Forward and reverse primer mix, by Thermo Fisher Scientific (1 mentions)
Sybr green supermix, by Thermo Fisher Scientific (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
6 protocols using cfx384 real time system c1000 thermocycler
1
RT-qPCR Analysis of Transcript Levels
2
RT-qPCR Analysis of Transcript Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From total RNA, cDNA was synthesized using iScript Reverse Transcriptase (BioRad, catalog #: 1708841). RT-qPCR assays were performed using SYBR Select Master Mix for CFX (Applied Biosystems) using Thermocycler C1000 CFX384 Real-Time System (BioRad). The primers used for amplification are listed in Supplementary Table 7 . Fold changes in transcript levels were calculated as lignan exposure relative to vehicle exposure using the ΔΔCT method.
3
Quantitative RT-PCR for Cardiac Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HL-1 cardiomyocytes utilizing the nucleospin RNA isolation kit (Machery-Nagel). First strand cDNA was generated by M-MLV reverse transcriptase (Invitrogen) and random hexamer primers (Promega). Relative changes in transcription level were determined using the CFX384 Real-time system C1000 thermocycler in combination with SYBR green supermix (both from BioRad Laboratories). Calculations were performed using the comparative computed tomography method according to User Bulletin 2 (Applied Biosystems). Fold inductions were adjusted for GAPDH levels. Primer pairs used included PARP1 F: CACCTTCCAGAAGCAGGAGA and R: GCAAGAAATGCAGCGAGAGT; PARP2 F: TCCTCTGGGCATCATCTTCT and R: AAGCTGGGAAAGGCTCATGT. CACNA1C F: CAAACAACAGGTTCCGCCTG and R: ATCTTTAGAGCAATTTCAATGGTGA. KCNQ1 F: GCCTCACTCATCCAGACTGC and R: GGACAGAAGCGTGTGACTCC. KCNH2 F: GGCGTACAGACAAGGACACA and R: CAGGGCCCTCATCTTCACTG. KCNJ3 F: TTCATCCTCCAACAGCACCC and R: GGCCATAGCTGCTTGCTAGA. GAPDH F: CATCAAGAAGGTGGTGAAGC and R: ACCACCCTGTTGCTGTAG. ACTB F: GGCTGTATTCCCCTCCATCG and R: CCAGTTGGTAACAATGCCATGT. Primer pairs used in Drosophila included PARP1 F: TGGTTTGCGTCAGGTGAAGA and R: TCGCGAAACCTGAAGTAGGC; Actin5C: F: GAGCACGGTATCGTGACCAA and R: GCCTCCATTCCCAAGAACGA.
4
Quantification of Dancr and miR-6324 in H9C2 Cardiomyocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from H9C2 cardiomyocytes using an RNA isolation kit (Total RNA Extraction Reagent; Vazyme Biotech Co., Ltd.). Total RNA was reverse transcribed into cDNA using a reverse transcriptase (Vazyme Biotech Co., Ltd.). Subsequently, qPCR was performed using the CFX384 Real-Time System C1000 Thermocycler (Bio-Rad Laboratories, Inc.) and SYBR-Green ROX-mix (Vazyme Biotech Co., Ltd.). The following primers were used for qPCR: Dancr forward, 5′-CTCGGATAGAAGCGCAGGTT-3′ and reverse, 5′-AGGCAAGCGGGGTCATTAAA-3′; miR-6324 forward, 5′-ATAGCTGGGGTCAAGGTGCT-3′ and reverse, 5′-CTTGCTGTCTGGCCTACTGA-3′; GAPDH forward, 5′-TTGTGCAGTGCCAGCCTC-3′ and reverse, 5′-GGTAACCAGGCGTCCGATAC-3′; and U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′. The following thermocycling conditions were used for qPCR: Initial denaturation at 95°C for 30 sec then 40 cycles of 95°C for 5 sec and 60°C for 15 sec, followed by default of melt curve. miRNA and mRNA expression levels were quantified using the 2−∆∆Cq method (37 (link)) and normalized to the internal reference genes U6 and GAPDH, respectively.
5
Mitochondrial DNA Quantification in Cardiomyocytes and Serum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was isolated from 200 µL medium from normal- or tachypaced HL-1 cardiomyocytes or 50 µL control patient/AF patient serum in 150 µL phosphate buffered saline (PBS) utilizing the Nucleospin Tissue kit (Macherey-Nagel, Landsmeer, The Netherlands) according to manufacturer’s instructions. Isolated DNA was used to determine DNA levels (a.u.) utilizing the CFX384 Real-time system C1000 Thermocycler (Bio-Rad, Lunteren, The Netherlands) in combination with SYBR green Supermix (Bio-Rad). Briefly, DNA, SYBR green Supermix and 10 µM forward and reverse primer-mix (Invitrogen, The Netherlands, Table 1 ) were added in a 384-well PCR plate (Bio-Rad) in triplicate per sample. Thermal cycling conditions were performed as a two-step approach using a pre-denaturating step at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min with data collection, ending with a melting curve analysis continuously from 60 °C to 95 °C. Mitochondrial DNA levels were adjusted for nuclear DNA levels (18S rRNA) [25 (link)] and analyzed using the ΔCT method.
6
Quantifying Mitochondrial Stress Markers in Cardiomyocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HL-1 cardiomyocytes utilizing the Nucleospin RNA isolation kit (Macherey-Nagel, Landsmeer, The Netherlands). First strand cDNA was generated using the iScript cDNA sysnthesis kit (Bio-Rad) and subsequently used as a template for quantitative real-time PCR. Relative changes in transcription level of the mitochondrial stress markers HSP60 and HSP10 were determined using the CFX384 Real-time system C1000 Thermocycler (Bio-Rad) in combination with SYBR Green Supermix (Bio-Rad). mRNA levels were expressed in relative units on the basis of a standard curve and adjusted for GAPDH levels. Primer pairs utilized are the following: HSP60 fw: TGACTTTGCAACAGTCACCC and rv: GCTGTAGCTGTTACAATGGGG, HSP10 fw: CTCCAACTTTCACACT-GACAGG and rv: GCCGAAACTGTAACCAAAGG and GAPDH fw: CATCAAGAAGGTGGTGAAGC and rv: ACCACCCTGTTGCTGTAG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!