All synthetic sequences (Table S1 ) were purchased from Integrated DNA Technologies Inc. (Coralville, IA, USA). D-glucose, pyruvate kinase from rabbit muscle, hexokinase from Saccharomyces cerevisiae, phospho(enol)pyruvic acid monopotassium salt (PEP), adenosine 5′-monophosphate disodium salt hydrate (AMP), cytidine 5′-monophosphate disodium salt (CMP), uridine 5′-monophosphate disodium salt (UMP), guanosine 5′-monophosphate disodium salt (GMP), adenosine 5′-diphosphate disodium salt hydrate (ADP), acetonitrile (ACN), 3-hydroxypicolinic acid (3-HPA), myokinase from rabbit muscle, sodium triphosphate pentabasic, and the DL-dithiothreitol (DTT) solution were purchased from Sigma-Aldrich (St. Louis, MO, USA). LwaCas13a protein was purchased from MCLAB (San Francisco, CA, USA). T4 polynucleotide kinase (T4 PNK) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). CutSmart® buffer was purchased from New England Biolabs Inc. (Ipswich, MA, USA). Diethyl pyrocarbonate distilled water (DEPC-DW) was purchased from Bioneer (Daejeon, Korea). The PGM was purchased from Accu-Chek Active (Roche, Basel, Switzerland).
T4 polynucleotide kinase t4 pnk
Manufactured by Thermo Fisher Scientific
Sourced in United States
T4 polynucleotide kinase (T4 PNK) is an enzyme that catalyzes the transfer of the gamma-phosphate from ATP to the 5' hydroxyl terminus of DNA, RNA, or oligonucleotides. It is an essential tool in molecular biology for labeling, modifying, and ligating nucleic acid molecules.
Automatically generated - may contain errors
Lab products found in correlation
Sodium triphosphate pentabasic, by Merck Group (1 mentions)
Pyruvate kinase from rabbit muscle, by Merck Group (1 mentions)
Cytidine 5 monophosphate disodium salt, by Merck Group (1 mentions)
Guanosine 5 monophosphate disodium salt, by Merck Group (1 mentions)
Uridine 5 monophosphate disodium salt, by Merck Group (1 mentions)
3 hydroxypicolinic acid 3 hpa, by Merck Group (1 mentions)
Cutsmart buffer, by New England Biolabs (1 mentions)
Acetonitrile, by Merck Group (1 mentions)
D glucose, by Merck Group (1 mentions)
Accu chek active, by Roche (1 mentions)
Ppicza vector, by Thermo Fisher Scientific (1 mentions)
T4 ligase, by Thermo Fisher Scientific (1 mentions)
Pgem vector, by Promega (1 mentions)
Kapa hifi polymerase, by Roche (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
λ exonuclease, by New England Biolabs (1 mentions)
Pfu dna polymerase, by Sangon (1 mentions)
T4 dna polymerase, by Thermo Fisher Scientific (1 mentions)
Phusion dna polymerase, by New England Biolabs (1 mentions)
5 protocols using t4 polynucleotide kinase t4 pnk
1
Efficient Enzymatic Analysis of Nucleotides
2
Cloning and Mutagenesis of Human Serum Albumin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG ) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech) and sense (CGCGAATTC ATGAAGTGGGTAACC ) and antisense (CGCCTCGAG TTATAAGCCTAAGGCAGC ) primers containing EcoRI and XhoI restriction sites (underlined), respectively. The amplified product was cloned into a pGEM vector (Promega), sequenced and subcloned into pPICZA vector (Invitrogen). The propeptide sequence (AGGGGTGTGTTTCGTCGA ) was deleted by PCR using primers flanking the target sequence (reverse GGAATAAGCCGAGCTAAAGAGAAAAAGAAGGG and forward GATGCACACAAGAGTGAGGTTGCTCATCGG ) previously phosphorylated with T4 polynucleotide kinase T4-PNK (Thermo Scientific). T4 ligase (Thermo Scientific) was used to blunt end ligate the PCR product. Domain I (DomI) coding region was obtained from the last by PCR amplification using KAPA HiFi polymerase (Kapa Biosystems) and specific sense (CGCGAATTC ATGAAGTGGGTAACC ) and antisense (CGCCTCGAG TTATTTGGCAGACGAAGCCTT ) primers containing EcoRI and XhoI restriction sites (underlined), respectively. Then it was subcloned back into pPICZA (pPICZA-DomI).
3
DNA Polymerase Reagent Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T4 DNA polymerase and T4 polynucleotide kinase (T4 PNK) were purchased from Fermentas. Pfu DNA polymerase was purchased from Sangon Biotech. Phusion DNA polymerase and λ exonuclease were purchased from New England Biolabs. Competent DH5α cells were prepared by the transformation and storage solution [15 (link)] or purchased from Beijing CoWin Bioscience.
4
Enzymatic Modification of Fluorescent Oligonucleotide
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S59CGTT (3′ FITC) was digested by 8 mg ml−1 pepsin at pH 3.8 NaH2PO4 buffer (25 mM NaH2PO4 and 200 mM NaCl) for 12 h then extracted using the phenol-chloroform method. Five microliters of S59CGTT (3′ FITC) products (2 μM), 1 μl of 10 × T4 PNK buffer, 1.25 μl of ATP (10 mM) and 0.75 μl of 10 U μl−1 T4 Polynucleotide Kinase (T4 PNK, Fermentas) were mixed together. Finally, 2 μl of H2O was added. Reactions were carried out at 37 °C for 0.5 h, then were heated to 75 °C to inactivate the enzyme.
Dephosphorylation reaction was similar to phosphorylation reaction, except S59CGTT (without FITC labeled 3′end) as the substrate. T4 PNK was replaced with FastAP (FastAPTM Thermosensitive Alkaline Phosphatase, Fermentas).
Dephosphorylation reaction was similar to phosphorylation reaction, except S59CGTT (without FITC labeled 3′end) as the substrate. T4 PNK was replaced with FastAP (FastAPTM Thermosensitive Alkaline Phosphatase, Fermentas).
5
Northern Blot Analysis of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (15 μg) was separated on a 1% agarose gel (1X MOPS (20 mM MOPS free acid, 5 mM sodium acetate, 1 mM EDTA, pH 7.0), 6.6% formaldehyde), in 1X MOPS buffer containing 0.7% formaldehyde. The RNAs were transferred onto a Nylon Hybond N+ membrane (GE Healthcare). The transfer was carried out on a capillary system overnight at room temperature in 20X SSC buffer. The cross-linking of RNAs on the 6X SSC-rinsed membrane was performed with UV (2X autocrosslinking, UV Stratalinker 1800). The oligonucleotides primers (Supplementary Table I) were labelled with gamma-32P ATP (Hartmann analytics) using the T4 Polynucleotide Kinase (T4-PNK, Fermentas) and purified over G-25 columns (GE Healthcare) as previously described [33 ]. The denatured primers were incubated with the membranes in hybridization buffer (Rapid-hyb buffer, GE Healthcare) overnight at 50°C. The membranes were washed with 1X SSC + 0.1% SDS for 20 min at 50°C and subsequently with 0.5X SSC + 0.1% SDS. The radioactive signal was visualized after 2 or 3 days of exposure using a phosphorimager (Typhoon Fla 9000, Fujifilm). 16S rRNA was used as a loading control. The approximate sizes of RNA transcripts were estimated using the RiboRuler High Range Ladder (Thermo Scientific). Each experiment was performed at least in independent triplicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!