Dnase q1

Total RNA was extracted using TRIsure isolation reagent (Bioline Reagents Ltd., UK) and treated with DNase Q1 (Promega corporation, USA). One μg of total RNA was subjected to reverse transcription using IScript cDNA Synthesis kit (Bio-Rad Laboratories Inc., USA). For real-time PCR, we used Go Taq qPCR Master mix (Promega Corporation, USA) in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories Inc., USA). Primer-specific amplification and quantification cycles were run at 95 °C for 25 s, 62 °C for 25 s and 72 °C for 30 s and a final extension of 72 °C for 20 s. To normalize the quantification of inhibins subunits and follistatin mRNA level, we measured the amount of ribosomal 18S mRNA in each protocol. The corresponding standard curve for each gene was obtained by serial dilution of a reference ovarian cDNA sample. Expression of the following genes was quantified using the following primers (presented 5′-3′). Inha-F: CCTTTTGCTGTTGACCCTACG and Inha-R: AGGCATCTAGGAATAGAGCCTTC (RefSeq ID: NM_010564.4); Inhba-F: CTTCGTCTCTAATGAAGG CAACC and Inhba-R: CTCCACCACATTCCACCTGTC (RefSeq ID: NM_008381.3); Inhbb-F: GGA GAACGGGTATGTGGAGA and Inhbb-R: TGGTCCTGGTTCTGTTAGCC (RefSeq ID: NM_008380.1); Follistatin-F: AAAACCTACCGCAACGAATG and Follistatin-R: TTCAGAAGAGGA GGGCTCTG (RefSeq ID: NM_010565.3).

The QIAamp DNA Mini Kit (Qiagen) was employed for the isolation of DNA from plasma, PB and individual cell subsets. Extraction of DNA from stool specimens was performed by the QIAamp DNA Stool Mini Kit (Qiagen) according to the manufacturer’s recommendations, and viral RNA was isolated with the RNeasy Kit plus (Qiagen), with subsequent DNA digestion with DNase Q1 (Promega). For further real-time quantitative (RQ)-PCR analyses, the RNA was transcribed into cDNA using the MLV reverse transcriptase (Promega).