Let 7a

The H2.35 cell line was directly obtained from ATCC and has been cultured for less than 6 months. The cells were authenticated by ATCC using Short Tandem Repeat (STR) DNA profiling. Cells were cultured in DMEM with 4% (vol/vol) FBS, 1x Pen/Strep (Thermo Scientific) and 200 nM Dexamethasone (Sigma). Cells were transfected with control (Life Technologies Cat. AM17010), let-7a (Life Technologies Cat. #4464084-Assay ID MH10050), or let-7g (Life Technologies Cat. #4464084-Assay ID MH11050) miRVana antiMiRs. AntiMiRs were packaged by RNAiMAX (Invitrogen) and transfected into H2.35 cells cultured in 96-well plates at a concentration of 50 nM. The number of viable cells in each well was measured at 2 and 3 days after transfection using CellTiter-Glo Luminescent Cell Viability Assay (Promega Cat. #G7570).

miRNAs were extracted from frozen tumor tissues using miRNeasy kit (Qiagen), according to the manufacturer’s instructions. The integrity of the extracted RNA was verified on an Agilent 2100 Bioanalyser (Agilent Technologies, Palo Alto, CA, USA). RNA concentrations were measured using a ND-1000 NanoDrop spectrophotometer (Labtech, Palaiseau, France). A total of 1 µg of extracted RNA was used for cDNA synthesis using miScript II RT kit (Qiagen), according to the manufacturer’s instructions. A total of 2.5 µL of diluted cDNA corresponding to 50 ng of reverse-transcribed RNA was analyzed with QuantiTect SybrGreen PCR Master Mix (Qiagen), in duplicate, using the LightCycler 480 real-time PCR system (Roche, Meylan, France). qRT-PCR data were analyzed using LightCycler 480 software (Roche, version 1.5). Ct levels were normalized to the geometric mean of the Ct values of 2 internal controls (housekeeping genes): Let7a (5′-TGAGGTAGTAGGTTGTATAGTT-3′, Invitrogen) and RNU44 (5′TGCTGACTGAACATGAAGGTCT-3′, Invitrogen, ThermoFisher Scientific). Primers for miR-30a-3p (HS_miR-30a-3p miScript primer assay, MIMAT0000088; 5′CUUUCAGUCGGAUGUUUGCAGC) and miR-30e-3p (HS_miR-30e-3p miScript primer assay, MIMAT0000693; 5′CUUUCAGUCGGAUGUUUACAGC) were purchased from Qiagen.

The isolated total RNA fraction was retro-transcribed using the Applied Biosystems™ High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). Real-Time PCR was carried out using the Applied Biosystems® 7500 Real-Time PCR System. A list of primers is shown in Supplementary Table 6. The miRNAs were amplified individually using miR-10a (ID000387), miR-10b (ID002218), miR-143 (ID002249), miR-411 (ID001610), miR-181a (ID000480), miR-125a (ID002198), miR-125b-1* (ID002378), miR-127 (ID002229), miR-654 (ID002239), miR-30a (ID000417), let-7a (ID000377) and RNU44 (ID001094) assays (Invitrogen Life Technologies). Expressions were determined by C_T and expression fold change was calculated as previously described^{58 (link)}.