Gamborg b5

Manufactured by Duchefa Biochemie

Gamborg B5 is a basal medium formulation that provides essential nutrients and vitamins required for plant cell and tissue culture applications. It is a widely used medium for the in vitro propagation and maintenance of various plant species.

Automatically generated - may contain errors

Lab products found in correlation

Pmpge010, by Thermo Fisher Scientific (1 mentions) Gateway lr reaction, by Thermo Fisher Scientific (1 mentions) Potato dextrose agar (pda), by BD (1 mentions)

8 protocols using gamborg b5

Nematode Infection and Tomato Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Meloidogyne incognita (Morelos strain), M. arenaria (Guadeloupe strain), and M. enterolobii (Godet strain) were multiplied on tomato (Solanum lycopersicum cv. "Saint Pierre") growing in a growth chamber (25°C, 16-h photoperiod). Freshly hatched J2s were collected as previously described (Caillaud and Favery, 2016) .
For VIGS experiments, N. benthamiana and tomato (cv M82) seeds were sown on soil and incubated at 4°C for two days. After germination, N. benthamiana and tomato plantlets were transplanted into pots containing soil and sand (1:1), and were grown at 24°C and 16°C, respectively (photoperiod, 16 h: 8 h, light: dark).
For RNAseq analysis, seeds of tomato (cv St Pierre) were surface-sterilized with chlorine solution (0.375% w/v active chlorine) and washed three times with 1 mL of milli-Q water. About 10-15 sterile seeds were sown on a Gamborg B5 (Duchefa Biochemie) agar plates (1x Gamborg B5; pH = 6.4; 1% w/v Sucrose; 0.7% w/v Agar), placed at 24°C for 48 h for germination, and finally transferred in a growth chamber (8-h light; 16-h dark, 20°C). Meloidogyne incognita J2s were sterilized with HgCl 2 (0.01% v/v) and streptomycin (0.7% w/v) as described before (Caillaud and Favery, 2016) . One to two weeks after germination, roots were inoculated with 1,000 sterile J2s resuspended in phytagel (5% w/v) per petri dishes.

Mejias J., Chen Y., Bazin J., Truong N.M., Mulet K., Noureddine Y., Jaubert-Possamai S., Ranty-Roby S., Soulé S., Abad P., Crespi M.D., Favery B, & Quentin M. (2022). Silencing the conserved small nuclear ribonucleoprotein SmD1 target gene alters susceptibility to root-knot nematodes in plants. Plant physiology, 189(3).

+ Open protocol

+ Expand

Tomato Protoplast Isolation and Transformation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protoplasts were isolated from in vitro shoot cultures of tomato as described (Shahin, 1985 (link); Tan et al., 1987 (link)). A total of 4 × 10⁷ protoplasts per sample were subjected to Polyethylene-glycol (PEG4000) mediated transformation (Negrutiu et al., 1987 (link)) with the following plasmids: (i) pK7FWG2 (Karimi et al., 2002 (link)) containing Rep from TYLCV (Genbank ID: FJ956702.1) fused to enhanced GFP (EGFP) (referred to as Rep-GFP), (ii) Rep-GFP + pJL-TRBO (Lindbo, 2007 (link)) containing tomato (Sl)PCNA fused to the FLAG tag at its N-terminus, referred to as FLAG-PCNA (positive control for interaction), and (iii) FLAG-PCNA as a negative control. Transfected protoplasts were incubated in Gamborg B5 (Duchefa Biochemie) liquid medium at 25°C overnight in dark conditions. Three independent protoplasts isolations and DNA transfections were performed on three different days. The next day the protoplasts were collected in 1.5 ml reaction vials by centrifugation (5 min at 85 g) and frozen at −80°C till further usage.

Maio F., Helderman T.A., Arroyo-Mateos M., van der Wolf M., Boeren S., Prins M, & van den Burg H.A. (2020). Identification of Tomato Proteins That Interact With Replication Initiator Protein (Rep) of the Geminivirus TYLCV. Frontiers in Plant Science, 11, 1069.

+ Open protocol

+ Expand

Simultaneous Disruption of E(z)2 and E(z)3 in Marchantia

Check if the same lab product or an alternative is used in the 5 most similar protocols

To construct a plasmid to disrupt E(z)2 and E(z)3 simultaneously, two oligonucleotide pairs (TH219: ctcgAAATAGAAAGTGGCGCCT/TH220: aaacAGGCGCCACTTTCTATTT for E(z)2; TH223: ctcgATCATATACCCTCGGCTC /TH224: aaacGAGCCGAGGGTATATGAT for E(z)3) were annealed and cloned into the BsaI sites of pMpGE_En04 and pBC-GE14 to yield pMpGE_En04-MpEz2-sg1 and pBC-GE14-MpEz3-sg1, respectively. These two plasmids were assembled via BglI restriction sites and ligated to yield pMpGE_En04-MpEz2-sg1-MpEz3-sg1. The resulting DNA fragment containing two MpU6promoter-gRNA cassettes was transferred into pMpGE010 (cat. no. 71536, Addgene) (Sugano et al., 2018) (link) using the Gateway LR reaction (Thermo Fisher Scientific Inc, Waltham, MA, USA) to yield pMpGE010_MpEz2-sg1-MpEz3-sg1. This construct was introduced into Cam-2 gemmae using the G-AgarTrap method (Tsuboyama, Nonaka, Ezura, & Kodama, 2018) . Transformants were selected for on 0.5 Gamborg B5 plates without vitamins (Duchefa Biochemie) supplemented with hygromycin and genotyped using the following primer pairs: TH300: TACGCCCTCTCCCATTGAAC/TH301: GATACGAAGAGAACGAACCTGC for E(z)2 and TH306: TGAGCTACATGGCTACTCTCAACC/TH307:
AGCTTGGAACACGGATCTCCTG for E(z)3.

Montgomery S.A., Hisanaga T., Wang N., Axelsson E., Akimcheva S., Šrámek M., Liu C., & Berger F. (2022). Polycomb-mediated repression of paternal chromosomes maintains haploid dosage in diploid embryos of Marchantia.

+ Open protocol

+ Expand

Cultivation and Genome Sequencing of Botrytis cinerea

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Strain B05.10 of B. cinerea Persoon:Fries is an isolate from Vitis vinifera (Table 1) and is used as recipient strain for genetic modifications. The genome sequence of B05.10 was published [50] (link) and recently updated by Staats and van Kan [51] (link). B. cinerea strains were cultivated on plates containing solid synthetic complete medium (CM) [52] (link), Gamborg B5 ( = GB5) +2% glucose (Duchefa, The Netherlands), modified Czapek-Dox (CD) as minimal medium (2% sucrose, 0.1% KH₂PO₄, 0.3% NaNO₃, 0.05% KCl, 0.05% MgSO₄ x 7 H₂O, 0.002% FeSO₄ x 7 H₂O, pH 5.0), or solid potato dextrose (PDA) agar (Sigma-Aldrich, Germany) supplemented with 10% homogenized bean leaves (PDAB). Cultures were incubated at 20°C under white light (12 h light/12 h darkness) for conidiation, and in continuous darkness for induction of sclerotia formation. For DNA isolation, mycelia were grown on solid CM with cellophane overlays.

Giesbert S., Siegmund U., Schumacher J., Kokkelink L, & Tudzynski P. (2014). Functional Analysis of BcBem1 and Its Interaction Partners in Botrytis cinerea: Impact on Differentiation and Virulence. PLoS ONE, 9(5), e95172.

+ Open protocol

+ Expand

Growth Conditions for M. polymorpha and A. thaliana

Check if the same lab product or an alternative is used in the 5 most similar protocols

The lines used in this study are described in SI Appendix, Table S1. All M. polymorpha gemmae were cultivated from gemmae under axenic conditions. All gemmae were grown on one-half-strength Gamborg B5 Basal (Duchefa Biochemie Cat.No G0209) media (pH 5.7) without B5 vitamins with 1% sucrose under continuous light (70

μ

E m

^{- 2}

^{- 1}

) at 22

^{°}

C. Gemmae for experiments were taken from 3- to 4-wk-old plants, and they were grown on one-half-strength Gamborg B5 Basal media (as above) without sucrose under the same conditions.
A. thaliana seeds were surface sterilized and sown on 1/2 MS. Seeds were stratified for 2 d at 4

^{°}

, then transferred to long-day 16 h light 8 h dark, 20

^{°}

C. Seedlings were grown vertically.

Bonfanti A., Smithers E.T., Bourdon M., Guyon A., Carella P., Carter R., Wightman R., Schornack S., Jönsson H, & Robinson S. (2023). Stiffness transitions in new walls post-cell division differ between Marchantia polymorpha gemmae and Arabidopsis thaliana leaves. Proceedings of the National Academy of Sciences of the United States of America, 120(41), e2302985120.

+ Open protocol

+ Expand

Monastrell Callus Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vitis vinifera L. cv. Monastrell calli were established as described by Calderon et al. [38 (link)] and maintained at 25 °C in darkness in 250 mL flasks containing 100 mL of fresh culture medium (Gamborg B₅, Duchefa, The Netherlands). Monastrell SCC was initiated by inoculating friable callus pieces in 250 mL Erlenmeyer flasks containing 100 mL of liquid Gamborg B₅ medium (pH 6.0) at 25 °C in the dark and were routinely maintained by periodic subcultures every 14–16 days as described by Belchí-Navarro et al. [39 (link)] and Almagro et al. [40 (link)].

Pietrowska-Borek M., Dobrogojski J., Wojdyła-Mamoń A.M., Romanowska J., Gołębiewska J., Borek S., Murata K., Ishihara A., Pedreño M.Á, & Guranowski A. (2021). Nucleoside 5′-Phosphoramidates Control the Phenylpropanoid Pathway in Vitis vinifera Suspension-Cultured Cells. International Journal of Molecular Sciences, 22(24), 13567.

+ Open protocol

+ Expand

Photoautotrophic Arabidopsis Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

A photoautotrophic Arabidopsis (Col-0) cell culture (PA) (Hampp et al., 2012 (link)) was used in this study. The PA cultures were maintained in two-tiered flasks placed in an orbital shaker under continuous illumination. The lower compartment contained a carbonate buffer that maintained a level of approximately 2% CO₂ in the upper compartment. Cultures were routinely diluted with growth medium (3.6 g/l Gamborg B5 (Duchefa), 1 g/l 2,4 dichloro-phenoxy-acetic acid, pH 5.7) after 3 weeks of growth. Experiments were performed with cultures grown for 7 days after the dilution. For the experiments, PA cells were harvested by centrifugation (8000 g, RT) and transferred to growth medium either without addition of further chemicals or supplemented with 500 µM 2,2'-DP or 100 µM ACI. After pre-incubation with ACI or DP for 2 hr in darkness, the buffer was exchanged for media supplemented with either 1 mM ALA, ACI + ALA, DP + ALA or buffer without additives. The treatment was performed for 16 hr in the dark. Cell culture samples (each 1 ml) were harvested by centrifugation (14,000 g, 4°C) and frozen in liquid nitrogen.

Richter A.S., Banse C, & Grimm B. (2019). The GluTR-binding protein is the heme-binding factor for feedback control of glutamyl-tRNA reductase. eLife, 8, e46300.

+ Open protocol

+ Expand

Cultivation of Botrytis cinerea B05.10

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

B. cinerea Pers. Fr. (Botryotinia fuckeliana [de Bary] Whetzel) strain B05.10 was isolated initially in Germany from a Vitis vinifera vineyard (80 (link)). This strain was used as the recipient for genetic modification. Its genome sequence was initially published (4 (link)) and significantly improved as a final gapless high-quality genome assembly (81 (link)).
The B. cinerea B05.10 wild-type strain, as well as genetically modified strains, were cultivated in petri plates (100 mm in diameter) containing one of the following agar-containing media: potato dextrose agar (PDA; Becton, Dickinson) with and without 10% homogenized bean leaves (termed PDAB; cultivated in greenhouses) or Gamborg B5 (Duchefa Biochemie) supplemented with 2% glucose, employed during the genetic transformation procedure (see below). Depending on specific culture conditions, PDA plates were also supplemented with sterile FeCl₃ (in a range between 100 and 750 μM). Since plants (see below) were routinely cultivated by employing a defined photoperiod, B. cinerea strains were also incubated in a 12:12-h light:dark regimen at 20°C using Percival incubators, as described previously (13 (link)).

Vasquez-Montaño E., Hoppe G., Vega A., Olivares-Yañez C, & Canessa P. (2020). Defects in the Ferroxidase That Participates in the Reductive Iron Assimilation System Results in Hypervirulence in Botrytis Cinerea. mBio, 11(4), e01379-20.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!