Plant dna kit

Manufactured by Omega Bio-Tek

Sourced in United States

The Plant DNA Kit is a laboratory tool designed for the efficient extraction and purification of high-quality genomic DNA from a variety of plant tissues. The kit utilizes a streamlined protocol to isolate DNA suitable for downstream applications such as PCR, sequencing, and molecular analysis.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) 500 750 μm glass beads, by Thermo Fisher Scientific (2 mentions) E z n a, by Omega Bio-Tek (1 mentions) Picogreen dsdna quantitation assay, by Thermo Fisher Scientific (1 mentions) Dna gel extraction kit, by Sangon (1 mentions) Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions) Taq dna polymerase, by Sangon (1 mentions) Nzy plant fungi gdna isolation kit, by NZYTech (1 mentions) Potato dextrose agar (pda), by Condalab (1 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions) Abi 3130 capillary sequencer, by Thermo Fisher Scientific (1 mentions) Abi 3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions) Nanodrop, by Thermo Fisher Scientific (1 mentions) Insect dna kit, by Omega Bio-Tek (1 mentions) Miseq platform, by Illumina (1 mentions) Soil dna kit, by Omega Bio-Tek (1 mentions) Monarch pcr cleanup kit, by New England Biolabs (1 mentions) Accustart 2 pcr supermix, by Quantabio (1 mentions) 3 mm tungsten carbide bead, by Qiagen (1 mentions) Tissue dna kit, by Omega Bio-Tek (1 mentions)

13 protocols using plant dna kit

Hornwort Tissue Extraction and DNA Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 168 hornwort samples were collected. Fresh hornworts were cleaned in sterile water to remove all adhering soil. They were first rinsed in multiple changes of sterile water using vortexing and forceps to dislodge soil particles. Once most of the soil was removed, the plants were sonicated in sterile water at 1% amplitude for 15 seconds in intervals of 3 seconds with 2 second rests in between. This protocol was determined by testing for the strongest sonication that would not break the hornwort cells. Plants were then blotted dry on clean Kimwipes and transferred to homogenization tubes with 2mm zirconia beads. Tubes holding the plants were frozen with liquid nitrogen and ground for two minutes at 1,300 strokes/min on a SPEX SamplePrep 1600 MiniG tissue homogenizer in a metal box pre-chilled in liquid nitrogen.
DNA was extracted from plant tissues using the E.Z.N.A. Plant DNA Kit (Omega Bio-Tek).

Nelson J., Hauser D., & Li F. (2020). Symbiotic cyanobacteria communities in hornworts across time, space, and host species.

+ Open protocol

+ Expand

Tobacco DNA Extraction and GFP Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from tobacco leaves using Plant DNA Kit (Omega Bio-tek, Norcross, GA, United States). The primers (Forward: 5′-ATGGCCGTTTTTATGGTGGTTTTTGCTGT-3′ and Reverse: 5′-CTAATAACTCGAAACTCGAATGC-3′) were used to amplify the open reading frame (ORF) of the SoCYP85A1 gene. For green fluorescent protein (GFP) analysis, fluorescence signal was detected with the NEWTON 7.0 smart imaging system (Vilber Lourmat, France).

Duan F, & Song W. (2019). Overexpression of SoCYP85A1 Increases the Accumulation of Castasterone and Confers Enhanced Black Shank Tolerance in Tobacco Through Modulation of the Antioxidant Enzymes’ Activities. Frontiers in Plant Science, 10, 349.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

About 1.5 g of the surface-sterilized plant sample was frozen with liquid nitrogen and ground to a fine powder in a sterilized and precooled mortar. DNA was extracted using a Plant DNA Kit (Omega Bio-Tek, Norcross, USA) and the V3-V4 hypervariable region of the bacterial 16S rRNA gene amplified using Bac 341f (5′-CCTACACGACGCTCTTCCGATCTN-3′) and Univ 805r (5′-GACTGGAGT TCCTTGGCACCCGAGAATTCCA-3′) primers. The 50 μl PCR reaction mixture contained 100 ng of DNA extract, 1× Taq reaction buffer, 20 pmol of each primer, 200 μM each dNTP and 1.5 U of Taq DNA polymerase (Sangong Biotech, China). DNA aliquots were PCR-amplified with 5 min denaturation at 95 °C, 30 cycles of 1 min at 94 °C, 50 s at 55 °C, and 72 °C for 1 min, after which a final elongation step at 72 °C for 5 min was performed. All samples were amplified. Replicate PCR products of the same sample were assembled within a PCR tube. Then they were visualized on agarose gels (2% in TBE buffer) containing ethidium bromide, and purified with a DNA gel extraction kit (Sangong Biotech, China). After purification, the concentration of the PCR products was measured on Qubit^®2.0 Fluorometer using the PicoGreen^® dsDNA quantitation assay (Invitrogen, Carlsbad, CA). DNA concentration was adjusted to 1 ng/ml. The amplicon libraries were prepared by pooling 10 ng of each PCR.

Yang R., Liu P, & Ye W. (2017). Illumina-based analysis of endophytic bacterial diversity of tree peony (Paeonia Sect. Moutan) roots and leaves. Brazilian Journal of Microbiology, 48(4), 695-705.

+ Open protocol

+ Expand

DNA Extraction from Fungal Mycelia

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fresh mycelia growing on PDA (Condalab, Madrid, Spain) plates at 22 °C was scraped and ground to a fine powder under liquid nitrogen in a mortar. DNA was extracted using the E.Z.N.A. Plant DNA kit (Omega Biotek, Norcross, GA, USA) or NZY Plant/Fungi gDNA Isolation kit (NZYTech, Lisbon, Portugal) following the manufacturer instructions. DNA obtained with the latter kit was used only for microsatellite analysis. DNA quantity and quality was measured using a spectrophotometer (NanoDrop 2000, ThermoFisher Scietific, Waltham, MA, USA). For molecular marker analysis, only high-quality DNA was used, with absorbance ratio 260/280 and 260/230 > 1.8.

Fariña-Flores D., Berbegal M., Iturritxa E., Hernandez-Escribano L., Aguín O, & Raposo R. (2023). Temporal and Spatial Variation in the Population Structure of Spanish Fusarium circinatum Infecting Pine Stands. Journal of Fungi, 9(2), 159.

+ Open protocol

+ Expand

DNA Extraction from Conidia and Spore Trap Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Conidia suspensions. DNA was extracted from conidia suspensions using the short protocol from the E.Z.N.A. Plant DNA Kit (Omega Bio-tek, Norcross, GA, USA), with modifications described by Zúñiga et al. (2018) as follows: 0.15 g of 500-750 μm glass beads (Acros Organics, Geel, Belgium) were added to 700 μL of the extraction buffer in each sample, and the samples were vortexed for 15 min at 50 Hz. DNA quality and concentration were checked and measured with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). DNA samples were stored at -20 °C until further use. Spore trap samples. DNA was extracted from the air-exposed plastic tapes used in the sporetrapping device (see below) by following the short protocol of the E.Z.N.A. Plant DNA Kit (Omega Bio-tek). Extraction, and DNA quantity and quality checking were conducted as described above and DNA was stored at -20 °C until further use.

Marimon N., Eduardo I., León M., Berbegal M., Armengol J, & Luque J. (2021). A qPCR-based method for the detection and quantification of the peach powdery mildew (Podosphaera pannosa) in epidemiological studies. Eur J Plant Pathol., 158(4).

+ Open protocol

+ Expand

Plant DNA Extraction from Leaf Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

E.Z.N.A. Plant DNA kit (OMEGA BIO-TEK Inc., PW, Norcross, GA, USA) was used for fungal DNA extraction from single leaves, representing each one of the sampled trees, and as we failed to extract DNA from one of the leaves, the molecular work for this study was conducted on only 71 leaf samples. Following the provider’s protocol, 30 mg of leaf powder was used in each extraction. DNA was eluted from the mini columns with 50 µl elution buffer and then stored in a 1.5 ml Eppendorf tube at -20 °C. The concentration of each DNA extract was measured using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE 19810, USA) at wavelengths of 260/280 and 260/230 nm.

Siddique A.B., Menke L., Dinedurga M, & Albrectsen B.R. (2023). Molecular studies of rust on European aspen suggest an autochthonous relationship shaped by genotype. Frontiers in Plant Science, 14, 1111001.

+ Open protocol

+ Expand

Genotypic Basis for Drought Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

Because the pine woodland under study results from reforestation activities, we verified the eventual genotypic basis for different responses to drought between D and H trees, as a possible consequence of different seeds provenances. Three chloroplast microsatellites loci [simple sequence repeats (SSRs)] were analysed (Naydenov et al., 2006 ). In April 2015, green needles of 50 trees per experimental category were collected from trees belonging to different age classes (20–100 years old), grinded in liquid nitrogen and stored frozen. Total DNA was extracted with the E.Z.N.A. kit (Plant DNA kit, Omega Bio-tek Inc, Norcross, GA, USA), quantified with a spectrophotometer (NanoDrop, Thermo Fisher Scientific, MA, USA) and three plastome microsatellites loci (Pt30204, Pt71936, Pt45002) were amplified with fluorescently labelled primers (Naydenov et al., 2006 ). Amplicons were resolved on agarose gel to verify amplification efficiency and quality and finally molecular weights were analysed using the ABI 3130 capillary sequencer with a ROX-labelled size standard (ABI 3130 Genetic Analyzer, Applied Biosystem, CA, USA). As a control, the same loci were also analysed in needles of three individuals of Pinus halepensis.

Savi T., Casolo V., Dal Borgo A., Rosner S., Torboli V., Stenni B., Bertoncin P., Martellos S., Pallavicini A, & Nardini A. (2019). Drought-induced dieback of Pinus nigra: a tale of hydraulic failure and carbon starvation. Conservation Physiology, 7(1), coz012.

+ Open protocol

+ Expand

BPH Sampling and DNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The collected BPH samples were frozen at − 20 °C for 5 min, immersed in 5% NaOCl (sodium hypochlorite), and rinsed with sterile distilled water five times to remove surface microorganisms. Total DNA was isolated from BPH adults and eggs using the Insect DNA kit (Omega Bio-tek, Inc., Norcross, GA, USA) according to the manufacturer’s instructions. Total DNA from infected and uninfected rice tissues was extracted using the Plant DNA Kit (Omega Bio-tek, Inc., Norcross, GA, USA) according to the manufacturer’s instructions. DNA concentrations were estimated using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

Ojha A, & Zhang W. (2019). A comparative study of microbial community and dynamics of Asaia in the brown planthopper from susceptible and resistant rice varieties. BMC Microbiology, 19, 139.

+ Open protocol

+ Expand

DNA Extraction from Conidia and Spore Trap Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Marimon N., Eduardo I., León M., Berbegal M., Armengol J., & Luque J. (2020). A qPCR-based method for the detection and quantification of the peach powdery mildew (Podosphaera pannosa) in epidemiological studies. European Journal of Plant Pathology, 158(4), 1005-1016.

+ Open protocol

+ Expand

Amplification and Sequencing of Glomeromycotan SSU

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted, respectively, from 1 g fresh rhizosphere soil samples and 0.5 g root samples using the Soil DNA Kit and the Plant DNA Kit (Omega Biotek) and stored at −20°C prior to further analysis. The Glomeromycotan ribosomal small subunit (SSU) was amplified using the forward primer AMV4.5NF (5′‐AAGCTCGTAGTTGAATTTCG‐3′) and the reverse primer AMDGR (5′‐CCCAACTATCCCTATTAATCAT‐3′) (Lumini et al., 2010 (link)). The 25‐μL PCR reaction mixtures contained 5× reaction buffer (5 μL), 5×GC buffer (5 μL), dNTP (2.5 mM, 2 μL), forward primer (10 μM, 1 μL), reverse primer (10 μM, 1 μL), DNA template (2 μL), ddH₂O (8.75 μL), and Q5 DNA polymerase (0.25 μL). The amplification parameters were as follows: 98°C for 2 min, followed by 25 cycles at 98°C for 15 s; at 55°C for 30 s; at 72°C for 30 s, and a final extension at 72°C for 5 min. The PCR products were purified and then sequenced on the Illumina Miseq platform in Shanghai Personal Biotechnology Co., Ltd. All raw sequences were deposited in the NCBI Sequence Read Archive under accession number SRP440790.

Chen X., Zhu Y., Feng M., Li J, & Shi M. (2024). Community responses of arbuscular mycorrhiza fungi to hydrological gradients in a riparian Phragmites australis wetland. Ecology and Evolution, 14(4), e11271.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!