Dynazyme 2 dna polymerase

The genomic DNA extracted as described above was used as the template for the PCR amplification of 16S rRNA using the bifido16S universal primers 357F/926R (357F 5′-CCTACGGGAGGCAGCAG-3′; 926R 5′-CCGTCAATTCMTTTRAGT-3′) and DyNAzyme II DNA polymerase (Thermo Scientific). The cycling parameters were: initial denaturation at 95°C for 5 min, followed by 35 cycles at 95°C for 30 s, 56°C for 45 s, and 72°C for 1 min, and a final extension at 72°C for 5 min. Each reaction was analyzed on 1% agarose gel. The resulting PCR products were subjected to DNA sequencing with an ABI 310 DNA sequencer (institutional facility). Sequence similarity was determined with the National Center for Biotechnology Information BLAST tool (NCBI).

We estimated the frequency of the asthenospermia-associated haplotype in 8557 Nordic Red cattle from the Nordic genomic selection reference population that had been genotyped at more than 50,000 SNPs [27 (link)]. Using Sanger sequencing, we genotyped the splice donor variant (GCA_000003055.3:Chr25:g.27138357C > T) in CCDC189 (transcript-ID: ENSBTAT00000045037) in 118 sires that were either identified as heterozygous carriers of the asthenospermia-associated haplotype (N = 30) or have been used frequently in AI (N = 88). PCR reactions for genotyping were done with the DyNAzyme II DNA Polymerase (Thermo Fisher, MA, US) in a 10 μl volume of 1x PCR buffer, 0.2 mM dNTPs, 10 pmol primer mix (forward 5′- CAAGGTCCTGCCCTTAAGAA -3′) and reverse primer: (reverse 5′- ATGCCATCACTCTGGACCTC-3′) and 150 pg of DNA. The cycling conditions were the following: a) an initial denaturation at 95 °C for 3 min, b) 29 cycles of 30 s denaturation (94 °C), 30 s hybridization (58 °C), 30 s elongation (72 °C), and c) a final 3 min elongation (72 °C). PCR products were purified and directly sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, CA, US). Electrophoresis of sequencing reactions was performed on 3500xL Genetic Analyzers (Applied Biosystems, CA, US), and sequences were visualized with Sequencher 5.4.6 (Gene Codes Corporation, MI, US).

Phylogenetic classification of the ExPEC strains into the A, B1, B2 and D groups used triplex PCR, based on amplification of chuA (a gene required for heme transport in enterohemorrhagic O157:H7 E. coli), yjaA (a gene detected from complete genome sequence of E. coli K-12 the function of which is unknown), and the DNA fragment TSPE4.C2 (from subtractive library of E. coli). The PCR used carried out in 50 µl final volume containing 1.25U DyNAzyme™ II DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) in 1×  PCR buffer, 0.2 µM of each dNTP, 2 mM MgCl₂, and 1 µM of each primer (Table 1). The PCR program included denaturation at 95 °C for 4 min, followed by 30 cycles of 95 °C for 5 s and 55 °C for 10 s, with a final extension step at 72 °C for 5 min (Clermont, Bonacorsi & Bingen, 2000 (link)). During the determination of the phylogenetic classification of the ExPEC isolates, the chuA gene encoding heme transport in enterohemorragic O157:H7 was the first evaluation step for the assigning the B2 or D group.

All PCR reactions were performed using Dynazyme II DNA Polymerase (Thermo Scientific) as per the manufacturer’s instructions in reaction volumes of 50 μL with 100 ng of DNA template and 1 U of Dynazyme. cDNA synthesis was performed using the SuperScript III First Strand Synthesis System (Thermo Scientific) with oligo(dT) as per the manufacturer’s instructions. Custom DNA primers were purchased from Integrated DNA Technologies and Sanger sequencing was performed by Eurofin Genomics. Primer sequences are listed in S1 File.

RAPD-PCR was performed with the OPA-10 primer (5′-GTGATCGCAG-3′), OPB-15 primer (5′-GGAGGGTGTT-3′), and RAPD-1 primer (5′-GTCGATGTCG-3′), as previously described by Hsueh et al.^{24 (link)} and Chiu et al.^{25 (link)}. Oligonucleotides were commercially synthesized by Genomics (Taiwan). The primers were resuspended in Tris-ethylenediaminetetraacetic acid buffer, stored at −20 °C, and 10 μM/μl working solutions were prepared for use in PCR.
The reaction mixture (25 μl) contained 10 mM Tris–HCl (pH 7.5), 50 mM KCl, 2.5 mM MgCl₂, 0.5 mM spermidine, 0.1 mM dNTPs, 15 pmol of the RAPD primer, 50 ng genomic DNA, and 0.8 U of DyNAzyme II DNA Polymerase (ABI, Thermo Fisher Scientific). For every sample, each RAPD reaction was performed at least twice for each DNA extract. Amplification was carried out in a ProFlex PCR system (Applied Biosystems) thermal cycler with one initial denaturation step of 5 min at 95 °C; 40 cycles of a denaturing step of 1 min at 94 °C, followed by an annealing step of 1 min at 36 °C, and an extension step of 2 min at 72 °C; and a final elongation step at 72 °C for 8 min. The RAPD reaction products were stored at −20 °C until further analysis.

For serotyping of all isolates used in this study, a multiplex PCR-based serotyping scheme for F. psychrophilum developed by Rochat et al. (2017) (link) was used. The multiplex PCR reactions were performed using 5 μL purified genomic F. psychrophilum DNA (NucleoSpin^® Microbial DNA, Macherey-Nagel) as the template in a 50 μL reaction mixture consisting of 2 units of DyNAzyme II DNA polymerase, 1× Optimized DyNAzyme buffer (Thermo Fisher Scientific), 10 mM dNTPs together with 10 μM of the four primer pairs described by Rochat et al. (2017) (link). The PCR reaction mixture was heated at 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 52°C for 30 s, 72°C for 60 s, and a final extension at 72°C for 10 min. The amplified PCR products were electrophoresed (4 V cm^–1, 60 min) on a 1% agarose-Tris-borate-EDTA gel stained with ethidium bromide and visualized under ultraviolet transillumination (Alpha Innotech Multi Image Light Cabinet). A 100 bp DNA ladder was used for fragment size estimation and subsequent classification into type 0 (188 bp), 1 (188 and 549 bp), 2 (188 and 841 bp), or 3 (188 and 361 bp).

Three fragments of the CYP2R1 gene were selected for Sanger sequencing analysis using the Primer-BLAST software (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome, accessed on 9 December 2021) available from the National Center of Biotechnology Information (NCBI). Primers were synthesized and purified by HPLC (Genomed, Warsaw, Poland). Primer sequences are provided in Supplementary Table S1.
PCR reactions for selected fragments of the CYP2R1 gene were carried out using DyNAzyme II DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) in a SimpliAmp™ Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA). The conditions for each pair of primers were determined experimentally (Supplementary Tables S2 and S3).