Iscript

Manufactured by Bio-Rad

Sourced in United States, Spain, Canada, Germany, Australia, Italy, Netherlands, United Kingdom

The IScript is a reverse transcription reagent kit designed for the conversion of RNA into complementary DNA (cDNA). It contains all the necessary components to perform reverse transcription, including an optimized reverse transcriptase enzyme, reaction buffer, and oligonucleotides. The IScript kit enables efficient and reliable cDNA synthesis from various RNA sources.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (145 mentions) Trizol reagent, by Thermo Fisher Scientific (85 mentions) Rneasy mini kit, by Qiagen (70 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (54 mentions) Rneasy kit, by Qiagen (43 mentions) Iq sybr green supermix, by Bio-Rad (32 mentions) Sybr green, by Bio-Rad (27 mentions) Itaq universal sybr green supermix, by Bio-Rad (24 mentions) Rneasy plus mini kit, by Qiagen (23 mentions) Ssofast evagreen supermix, by Bio-Rad (22 mentions) Sybr green master mix, by Thermo Fisher Scientific (18 mentions) Nanodrop, by Thermo Fisher Scientific (18 mentions) Rnalater, by Thermo Fisher Scientific (18 mentions) Trisure reagent, by Meridian Bioscience (17 mentions) Cfx96 system, by Bio-Rad (17 mentions) Ssoadvanced universal sybr green supermix, by Bio-Rad (17 mentions) Power sybr green, by Thermo Fisher Scientific (16 mentions) Sybr green supermix, by Bio-Rad (15 mentions) Brilliant sybr green qpcr supermix, by Bio-Rad (15 mentions) Tri reagent, by Merck Group (15 mentions)

772 protocols using iscript

Quantitative RT-PCR Analysis of Heterochromatic Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using Trizol and RNeasy (Qiagen) columns. For assessing the abundance of the APC7 and Ki-67 transcripts, we generated cDNA using the Bio-Rad iScript with polyA selection. A no RT control was used for each amplicon to ensure there was not spurious amplification of contaminating DNA. Each amplicon was designed to be 100–250 nucleotides and to span an intron >1 kb. We used the SYBR green reagent and the QuantStudio 6 machine (Applied Biosystems).
For assessment of expression of repetitive sequences that are enriched in constitutive heterochromatin (e.g. major satellite, LINE and IAP), we began by isolating RNA as described above. We then treated RNA with DNase I (NEB) according to the manufacturer’s protocol. We generated cDNA using Bio-Rad iScript without polyA selection and included the essential no RT control in our experiment. The abundance of each transcript was normalized to GAPDH we subtracted the signal observed under no RT conditions from the amount of transcript detected in the RT condition to compensate for the small amount of DNA remaining after DNase treatment.

Ferguson C.J., Urso O., Bodrug T., Gassaway B.M., Watson E.R., Prabu J.R., Lara-Gonzalez P., Martinez-Chacin R.C., Wu D.Y., Brigatti K.W., Puffenberger E.G., Taylor C.M., Haas-Givler B., Jinks R.N., Strauss K.A., Desai A., Gabel H.W., Gygi S.P., Schulman B.A., Brown N.G, & Bonni A. (2021). APC7 Mediates Ubiquitin Signaling in Constitutive Heterochromatin in the Developing Mammalian Brain. Molecular cell, 82(1), 90-105.e13.

+ Open protocol

+ Expand

Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Trizol according to the manufacturer's protocol (Trizol, cat#10296-010, Invitrogen, Life Technologies Europe BV, Bleiswijk, the Netherlands). The electrospun mesh was homogenized in Trizol using a Precellys 24 tissue homogenizer (Precellys, Bertin Technologies, Aix-en Provence, France). cDNA was synthesized using iScript according to the manufacturer's protocol (iScript, Cat#170-8891, Bio-Rad, Hercules, California, United States). qPCR was analyzed using the deltaedelta CT method, normalized to P0 expression.

Muylaert D.E., van Almen G.C., Talacua H., Fledderus J.O., Kluin J., Hendrikse S.I., van Dongen J.L., Sijbesma E., Bosman A.W., Mes T., Thakkar S.H., Smits A.I., Bouten C.V., Dankers P.Y, & Verhaar M.C. (2016). Early in-situ cellularization of a supramolecular vascular graft is modified by synthetic stromal cell-derived factor-1α derived peptides. Biomaterials, 76.

+ Open protocol

+ Expand

Gene Expression Analysis of Frozen Tissue

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

After the samples were snap-frozen in liquid nitrogen, they were stored in a −80°C freezer. Frozen tissue was homogenized using the Mini-Beadbeater™ (BioSpec Products, Bartlesville, OK, USA), and RNA isolation was performed with the Quick-RNA isolation kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s protocols. RNA concentration was measured with an Eppendorf μCuvette® G1.0 on the BioPhotometer® D30 (Eppendorf, Hamburg, Germany), and 1 μg of RNA was used for cDNA synthesis (iScript; Bio-Rad, Hercules, CA, USA). The cDNA was 10-fold diluted with sterile deionized water, of which 2 μl was used in a 20-μl SYBR Green reaction mix (SsoAdvanced; Bio-Rad). All reactions were run in a CFX96 thermocycler (Bio-Rad). Gene expression was normalized to PP2A and SAND with similar results (Czechowski et al., 2005 (link); Zhang et al., 2015 (link)). All primers used are listed in Table S1.

Sowders J.M, & Tanaka K. (2023). A histochemical reporter system to study extracellular ATP response in plants. Frontiers in Plant Science, 14, 1183335.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for ALK5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The frozen lung tissue was homogenized and total RNA was isolated using Tripure RNA isolation kit (Roche, Basel, Switzerland Cat#11667165001). cDNA synthesis was performed with iScript (Bio-Rad, Hercules, USA, Cat#170-8891), followed by real-time PCR using the SYBR Green and a Bio-Rad CFX Connect device. Primers used for real-time PCR for ALK5: Fw: GCTGACATCTATGCAATGGGCTTA, Rv: AGGCAACTGGTAGTCTTCGTGGA; GAPDH: Fw: GGTGGACCTCATGGCCTACA, Rv: CTCTCTTGCTCTCAGTATCCTTGCT. GAPDH served as a control for the amount of cDNA present in each sample. Data were analysed using the comparative difference in cycle number (ΔCT) method according to the manufacturer’s instructions. Q-PCR relative quantification was realized by calculating the ratio of the protein expression of interest over the GAPDH mRNA expression [15 (link)].

Rotteveel L., Poot A.J., Kooijman E.J., Schuit R.C., Schalij I., Sun X., Kurakula K., Happé C., Beaino W., ten Dijke P., Lammertsma A.A., Bogaard H.J, & Windhorst A.D. (2023). Imaging the TGFβ type I receptor in pulmonary arterial hypertension. EJNMMI Research, 13, 23.

+ Open protocol

+ Expand

Influenza Virus Infection and Reinfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were infected with influenza virus A/X/31 (X31) and re-infected with adapted human influenza virus A/PR/8/34 (PR8) one month later. Mice (N = 5 / genotype) were exposed to aerosolized (Glas-Col) 500 TCID of X31 or PR8 in 7mL of saline. Expression of viral nucleoprotein (NP) in the lungs of infected mice was determined by real time PCR. For this purpose, RNA was extracted from the tissues using Pure link RNA mini kit (Thermo Fisher Scientific) and was reverse transcribed to cDNA (iScript, Bio-Rad) according to the manufacturer’s instructions. Reactions were cycled and quantitated with an ABI 7500 Fast Real Time PCR System (Applied Biosystems). All assays were performed with N = 3 or more per condition and repeated 3 times. Relative level of viral RNA was normalized to b-actin.

Raud B., Roy D.G., Divakaruni A.S., Tarasenko T.N., Franke R., Ma E.H., Samborska B., Hsieh W.Y., Wong A.H., Stüve P., Arnold-Schrauf C., Guderian M., Lochner M., Rampertaap S., Romito K., Monsale J., Brönstrup M., Bensinger S.J., Murphy A.N., McGuire P.J., Jones R.G., Sparwasser T, & Berod L. (2018). Etomoxir actions on regulatory and memory T cells are independent of Cpt1a-mediated fatty acid oxidation. Cell metabolism, 28(3), 504-515.e7.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Epithelial cells, BMDMs, and THP-1 macrophage-like cells, RAW264.7 cells were lysed in TRIzol^™ reagent (Invitrogen). Total RNA was isolated using TRIzol^™ reagent (Invitrogen) following the manufacturer’s instructions. Isolated RNA was reverse transcribed into cDNA using iScript (Bio-Rad). Real-time PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad). Individual expression data was normalized to GAPDH as described earlier (45 (link)). Primers used for qRT-PCR are listed in Table S1.

Khan S., Shafiei M.S., Longoria C., Schoggins J., Savani R.C, & Zaki H. (2021). SARS-CoV-2 spike protein induces inflammation via TLR2-dependent activation of the NF-κB pathway. bioRxiv.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Before RNA extraction, snap-frozen wounds were homogenized as previously described (47 (link)). Once homogenized, wounds, keratinocytes, and isolated monocyte/MΦ were placed in TRIzol (Invitrogen). RNA was isolated using chloroform, isopropanol, and ethanol. iScript (Bio-Rad) was then used to reverse transcribe RNA to cDNA. Real-Time PCR was performed with 2× TaqMan PCR Mix or 2× SYBR Green mix via the 7500 Real-Time PCR System. Primers used were as follows: murine Ifnk (forward, 5′-TACGATAGGAGACGGCGTTTA-3′; reverse, 5′-ACTCCAAAGTTTTTATGGCTGGT-3′), Il1b (Mm00434228), Tnfa (Mm00443258), Il12 (Mm00434165), human IFNk (forward, 5′-GTGGCTTGAGATCCTTATGG GT-3′; reverse, 5′-CAGATTTTGCCAGGTGACTCTT-3′), Mll1 (Mm01179235), Col1 (Mm00801666), Vegfa (Mm00437306), and 18s (no. 4318839) as internal control (Applied Biosystems). All real-time PCR experiments were run on a 7500 Real-Time PCR System (Applied Biosystems). Data were examined in a relative quantification analysis to 18S (2^–ΔΔCt). All samples were performed in triplicate.

Wolf S.J., Audu C.O., Joshi A., denDekker A., Melvin W.J., Davis F.M., Xing X., Wasikowski R., Tsoi L.C., Kunkel S.L., Gudjonsson J.E., O’Riordan M.X., Kahlenberg J.M, & Gallagher K.A. (2022). IFN-κ is critical for normal wound repair and is decreased in diabetic wounds. JCI Insight, 7(9), e152765.

+ Open protocol

+ Expand

GBM Cell RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from patient-derived GBM cells using the Aurum total RNA Mini Kit (Bio-Rad) according to manufacturer’s protocol and cDNA was synthesized using iScript (Bio-Rad). Each sample of cDNA was quantitated and diluted to an equal concentration of 10 ng/mL. The Applied Biosystems 7300 real-time PCR machine was used for the quantitative real-time PCR (qRT-PCR), using SYBR Green Supermix (Bio-Rad). All primers, as described in Additional file 1: Table 2, were purchased from Invitrogen. ACTB was used for normalization of the genes of interest. The results were analyzed using 2^−ΔΔCT method and expressed as fold change to respective non-treated controls.

Martell E., Kuzmychova H., Senthil H., Kaul E., Chokshi C.R., Venugopal C., Anderson C.M., Singh S.K, & Sharif T. (2023). Compensatory cross-talk between autophagy and glycolysis regulates senescence and stemness in heterogeneous glioblastoma tumor subpopulations. Acta Neuropathologica Communications, 11, 110.

+ Open protocol

+ Expand

Adipose Tissue Tip60 Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Snap-frozen epididymal adipose tissue was homogenized and RNA was extracted using Trizol (Invitrogen). RNA was purified on an RNeasy micro column (Qiagen), RNA integrity was checked with a Bioanalyzer (Agilent), and cDNA synthesis was performed with iScript (Bio-Rad). Quantitative PCR with SYBR Green (Bio-Rad) was run on a MyIq machine (Bio-Rad). Primers for quantitative RT-PCR were designed with the universal probe library (Roche); sequences were as follows: mTip60 Forw 5′-GCTGCTTATTGAGTTCAGCTATG-3′; mTip60 Rev 5′-GGATCTCCAAGATGGTTTGG-3′; m36B4 Forw 5′-AGCGCGTCCTGGCATTGTGTGG-3′; m36B4 Rev 5′-GGGCAGCAGTGGTGGCAGCAGC-3′.
For protein analysis, epididymal white adipose tissue (eWAT) was lysed with M-PER Mammalian Protein Extraction Reagent (Thermo Fisher Scientific, Etten-Leur, The Netherlands) and proteins were analyzed by Western blotting as described [12] (link), [19] . Controls were generated by transient transfection of HEK293T cells (ATCC, Manassas, VA) with empty expression vector (pCDNA3.1) or an expression vector encoding HA-tagged Tip60 (isoform 2), as described [15] .

Gao Y., Hamers N., Rakhshandehroo M., Berger R., Lough J, & Kalkhoven E. (2014). Allele Compensation in Tip60+/− Mice Rescues White Adipose Tissue Function In Vivo. PLoS ONE, 9(5), e98343.

+ Open protocol

+ Expand

Bead-based Angiogenesis Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

This assay measures sprouting angiogenesis (Nakatsu et al., 2007) and was performed essentially as described. TGF-b1 (100-B; R&D Systems) and SB-431542 (4317; Sigma-Aldrich) were used at indicated concentrations. High-resolution images were captured on Zeiss Axio Observer Z1 microscope. Images were analyzed using NIH ImageJ. Number of sprouts per bead, sprout length, and the area of endothelium around bead were measured in pixel units.
RNA Isolation and qRT-PCR RNA was isolated from bead angiogenesis assays after removing fibroblasts using trypsin. Trizol (10296; GIBCORL) was used for extraction. RNA was cleaned using the RNeasy-MiniElute Cleanup Kit (74204; QIAGEN) and reverse-transcribed using iScript (172-5037; Bio-Rad) followed by amplification using SYBR Green qPCR Master Mix (172-5721; Bio-Rad). Primers are detailed in Table S1.

Li Q.F., Decker-Rockefeller B., Bajaj A, & Pumiglia K. (2018). Activation of Ras in the Vascular Endothelium Induces Brain Vascular Malformations and Hemorrhagic Stroke. Cell reports, 24(11).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!