Iscript

RNA from NRVM were isolated using Quick-RNA (Zymo Research, Irvine, CA, USA) according to manufacturer’s directions. RNA was reverse transcribed using iScriptTM (Biorad, Hercules, CA, USA) following manufacturer’s protocol. Quantitative PCR was performed with the TaqMan method on a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). Relative expression was calculated using the ^ΔΔCt method, with normalization to Gapdh. Specific primer/probe sequences are available upon request.

Heart tissue samples were disrupted in PureZOL^TM (Biorad) in a Tissue-lyzer (Qiagen) using stainless steel beads (30 Hz for a total of 4 min). Aurum^TM (Biorad) RNA isolation kit was used to isolate total RNA according to manufacturer’s directions. For qPCR analysis, total RNA was loaded onto columns and DNase treated before being transcribed to complementary DNA using iScript^TM (Biorad) according to manufacturer’s directions. TaqMan method was used for qPCR analysis (using the Roche Universal Probe Library System) using an ABI Step One Plus Real-Time PCR System. ΔΔCt method (with normalization genes indicated in figure legend)was used to assess relative expression. Primer sequence for Slc25a20: Forward 5’-ATCCGCGGCTTCTACAAAG-3’, Reverse 5’-TACATCCCACTGGCAGGAAC-3’. Primer sequence for Cpt1b: Forward 5’-TGCCTTTACATCGTCTCCAA-3’, Reverse 5’-GGCTCCAGGGTTCAGAAAGT-3’. Primer sequence for Cpt2: Forward 5’-CCAAAGAAGCAGCGATGG-3’, Reverse 5’-TAGAGCTCAGGCAGGGTGA-3’. Primer sequence for Fabp3: Forward 5’-CTTTGTCGGTACCTGGAAGC-3’, Reverse 5’-TGGTCATGCTAGCCACCTG-3’. Primer sequence for Glut4: Forward 5’-TCGTCATTGGCATTCTGGT-3’, Reverse 5’-AGCAGTGGCCACAGGGTA-3’. Primer sequence for Glut1: Forward 5’-ATGGATCCCAGCAGCAAG-3’, Reverse 5’-CCAGTGTTATAGCCGAACTGC-3’. Primer sequence for Ppib: Forward 5’-TTCTTCATAACCACAGTCAAGACC-3’, Reverse 5’-ACCTCCGTACCACATCCAT-3’.

Samples were homogenized using Tripure isolation reagent (Roche Diagnostic, USA). The RNA extracted was subsequently reverse transcribed into complementary DNA (cDNA) using a commercial kit (1708891, Bio-Rad iScriptTM). The resulting cDNA was then amplified, employing Bio-Rad iQ SYBR Green Supermix (1708880, Bio-Rad). The quantitative polymerase chain reaction (qPCR) program comprised an initial step at 95 °C for 3 min, followed by 40 cycles (95 °C for 15 s and 60 °C for 60 s), and finally, a step at 95 °C for 1 min. Data analysis was carried out using the ΔΔCT method. The following oligonucleotide primers were employed:

Gene	Forward primer	Reverse primer
SREBP-2	5ʹ-TCACTCCCTGGGAAAGT-3ʹ	5ʹ-CAGTAGCAGGCAGGCAGGCAGGCAGCAGGTCTCACAGGT-3ʹ
HMGCR	5ʹ-GGACTTCGAGCAAGAGAGAGAGAGAGAGAGAGAGAGAGATGGG-3ʹ	5ʹ-AGCACTGTGTTGCGTACAG-3ʹ
ß-actin	5ʹ-TCTTATTGGTCGAAGGCTCGT-3ʹ	5ʹ-ATCTCACTAGAGGCCACCGA-3ʹ

RNA was isolated from mycoplasma cells or lysate by the hot phenol extraction method (26 ). Isolated RNA fractions were resuspended in nuclease-free water, and their concentration was measured by spectrophotometry (Nanodrop™, ThermoFisher). RNA was diluted to a concentration of 1 µg/µl, and 5 µl of each sample was analyzed by performing denaturing polyacrylamide gel electrophoresis (8% acrylamide/bis-acrylamide, 8 M urea, 0.5× Tris/Borate/EDTA buffer, 250 V for 45 min). Gels were stained with SYBR^TM-Gold (Invitrogen). Alternatively, total RNA fractions were analyzed using chip-based capillary electrophoresis in agarose gel (RNA 6000 Nano kit, Agilent 2100 Bioanalyzer). For that, samples were diluted to a 500-ng/µl final concentration, of which 1 µl of each sample was analyzed in the chip. The Bioanalyzer total RNA plots show arbitrary fluorescence units (y-axis) versus migration time (x-axis). For better data interpretation, the x-axis was converted to RNA size using an RNA ladder as reference (25–6000 nt). RNA was converted into a cDNA library (iScript^TM, Bio-Rad) for the quantitative polymerase chain reaction (qPCR) experiment (iQ^TM SYBR^® Green Supermix, Bio-Rad). qPCR was performed with primers for 23S rRNA (see Supplementary Table S4 for sequences).

RNA was extracted from 100 to 200 worms per group using Trizol (Invitrogen). Genomic DNA contamination was removed with Turbo DNase (QIAGEN), cDNA was synthesized using iScriptTM (Bio-Rad), and quantitative real-time PCR was carried out using Bio-Rad’s SsoAdvanced Universal SYBR Green Supermix, and on a StepOnePlus system (Applied Bio). Ct values were normalized to the respective actin values for each sample, and are presented as fold change over wild-type worm expression value. See Supplementary Table 4 for primer sequences.

cDNA was generated with iScript^TM (BioRad; Hercules, California) according to the manufacturer’s instructions. qRT-PCR was performed using POWER Syber master mix (Thermo Fisher Scientific) with the following primers:

mMc4r F	Cccggacggaggatgctat
mMc4r R	TCGCCACGATCACTAGAATGT
mPpargc1aF	GCCGTGACCACTGACAACGAGGC
mPpargc1a R	GCCTCCTGAGGGGGAGGGGTGC
mMyl4 F	CGGACTCCAACGGGAGAGAT
mMyl4 R	GCTCCTTGTTGCGGGAGAT
mH19 F	GTACCCACCTGTCGTCC
mH19 R	GTCCACGAGACCAATGACTG
mCytb F	GTCCACGAGACCAATGACTG
mCytb R	ACTGAGAAGCCCCCTCAAAT

All PCR was performed on using standard cycling conditions on a Quantstudio 12 k Flex Real Time PCR system (Thermo Fisher Scientific). Data was analyzed using the ΔΔCT method. All statistics were performed by comparing ΔCT values between groups and plotted as Fold Change ± SEM (2^ΔΔCT).

RNA used for qRT-PCR validation was the same as was used for RNA sequencing. cDNA was synthesized from 500 ng RNA using the iScript^TM reverse transcription supermix (BioRad) as per the manufacturer’s instructions. The cDNA was diluted to 0.25 ng/μL for qRT-PCR.
qRT-PCR analyses were performed and analyzed as previously described [3 (link)]. Primer sequences were designed using Primer3 software [57 (link)] based on transcript sequences from the de novo transcriptome assembly and can be found in Additional file 1: Table S24. PsTUBULIN2 was used as the reference gene.