A laboratory colony of Amblyomma americanum is maintained at the Knipling-Bushland U.S. Livestock Insects Research Laboratory and Arthropod Genomics Center (USDA-ARS, Kerrville, TX, USA) [33 (link)]. Total RNA was prepared from larvae according to the manufacturer’s instructions (Monarch® Total RNA Miniprep Kit, New England BioLabs, Inc., Ipswich, MA USA; or Quick-RNA Microprep kit, Zymo Research, Irvine, CA, USA). Salivary glands or synganglia were dissected from 14 unfed adult females, placed in a DNA/RNA Shield (Zymo Research, Irvine, CA, USA ) and frozen at −80 °C until preparation of tissue specific total RNA (Monarch® Total RNA Miniprep Kit, New England BioLabs, Inc., Ipswich, MA USA). Salivary gland extracts were prepared from unfed adult female ticks (without grinding) as previously described [11 (link)]. Synganglion extracts were prepared from unfed adult female ticks as described by Pruett and Pound [34 (link)].
Monarch total rna miniprep kit
Manufactured by New England Biolabs
Sourced in United States, United Kingdom, Germany, Japan, Canada
The Monarch Total RNA Miniprep Kit is a tool designed for the rapid and efficient extraction of high-quality total RNA from a variety of sample types. It utilizes a simplified workflow and optimized reagents to achieve reliable RNA purification.
Automatically generated - may contain errors
Lab products found in correlation
Lunascript rt supermix kit, by New England Biolabs (38 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (36 mentions)
Luna universal qpcr master mix, by New England Biolabs (32 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (17 mentions)
Turbo dnase, by Thermo Fisher Scientific (12 mentions)
Trizol, by Thermo Fisher Scientific (12 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (11 mentions)
Iscript cdna synthesis kit, by Bio-Rad (10 mentions)
Nanodrop, by Thermo Fisher Scientific (10 mentions)
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (9 mentions)
Luna universal one step rt qpcr kit, by New England Biolabs (8 mentions)
Lightcycler 480, by Roche (8 mentions)
Dnase 1, by New England Biolabs (7 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (7 mentions)
Protoscript 2 first strand cdna synthesis kit, by New England Biolabs (6 mentions)
Novaseq 6000, by Illumina (6 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (6 mentions)
Superscript 4 first strand synthesis system, by Thermo Fisher Scientific (6 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (6 mentions)
327 protocols using monarch total rna miniprep kit
1
Collecting and Extracting Tick RNA and Proteins
2
Transcriptome Analysis of lsr2 Mutant Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type and lsr2 mutant strains were grown until exponential growth phase with optical density value 600 nm (OD600) of 0.6 corresponding to approximately 2.4 × 108 cells/mL. A total of 4.8 × 109 cells were harvested, and total RNA from three biological replicates was extracted for each strain using the Monarch Total RNA Miniprep Kit (NEB). After DNase I treatment and elution, RNA concentrations were measured using the Qubit fluorometer (Promega). RNA integrity was evaluated using the Bioanalyzer system (Agilent), and all samples used for library preparation showed RNA integrity number scores >8. rRNA depletion was performed using the NEBNext rRNA Depletion Kit (Bacteria) (NEB), and the sequencing libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit (NEB) following manufacturer’s instructions. RNA from lsr2 complemented strains used for RT-qPCR experiments was extracted using the Monarch Total RNA Miniprep Kit (NEB).
3
RNA Extraction from Listeria monocytogenes
Check if the same lab product or an alternative is used in the 5 most similar protocols
L. monocytogenes was cultured using Brain Heart Infusion (BHI) broth at 37 °C for 22 h. Total RNA extract of L. monocytogenes was performed according to the previous report.[12 ] Particularly, 1 mL of the culture was centrifuged at 16 000 × g for 2 min to harvest the cell pellet. 250 µL of 3 mg mL−1 lysozyme diluted in TE buffer was added to suspend the cell pellet followed by incubation at 37 °C for 1 h. Total RNA was extracted using the Monarch Total RNA Miniprep Kit (NEB, T2010). Specifically, 40 µL of RNA with DNA contamination sample was eluted in nuclease‐free water. Then, 20 µL of DNase I (NEB, cat. # T2004‐1, 20 U), and 20 µL of DNase I reaction buffer were added to the eluted sample and incubated at 37 °C for 30 min for DNA digestion. Finally, RNA Priming Buffer and Wash Buffer were used for RNA purification. The RNA extract was quantified by high sensitivity Qubit Assay and Nanodrop, respectively, and stored at −80 °C. A similar protocol was used for preparing the community standard, which consists of E. coli O157:H7, S. Enteritidis, and L. monocytogenes. Particularly, a single colony of each strain was inoculated in 10 mL of BHI medium, respectively, followed by incubation at 37 °C for 24 h. 2 mL of each overnight culture was used for total RNA extraction using NEB Monarch Total RNA Miniprep Kit.[12 ]
+ Expand
L. monocytogenes was cultured using Brain Heart Infusion (BHI) broth at 37 °C for 22 h. Total RNA extract of L. monocytogenes was performed according to the previous report.[
4
RNA Extraction from Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total or nuclear RNA was extracted using either TRIzol (Life Technologies) or RNA lysis reagent from the Monarch Total RNA Miniprep Kit (NEB) as per the manufacturer’s instructions. For TRIzol extraction, TRIzol was added to cells, vortexed, and chloroform was added to the TRIzol sample according to the manufacturer’s instructions (200μL of chloroform per 1mL of TRIzol Reagent) and vortexed, before centrifugation at 12,000g for 15 min at 4°C. The aqueous phase was collected and used in the Monarch Total RNA Miniprep Kit (NEB) as per the manufacturer’s instructions. RNA was eluted in water and quantified using the Implen Nanophotometer N60.
5
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from lung tissues or HBECs was isolated using the Monarch Total RNA Miniprep Kit (New England Biolabs), and cDNAs were synthesized with the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher). Quantitative real-time PCR analysis was performed using the Power SYBR Green PCR Master Mix (ThermoFisher) on an ABI Prism 7300 detection system. Data were analyzed using the 2−ΔΔCT method relative to the housekeeping gene Actin (43 (link)). Primer sequences are provided in the Online Repository (see Table E1
6
Cloning and Expressing Schistosome GPCRs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rna was isolated from adult schistosomes or yeast clones with the Monarch® Total RNA Miniprep Kit (NEB) and transcribed into cDNA using ProtoScript® II reverse transcriptase (NEB). Both steps were carried out following the manufacturer instructions. PCR analysis for cloning full-length GPCR coding sequences and expression in yeast was performed with primer pairs as indicated in Supplementary Table 2. In brief, amplification was done with Q5 High-Fidelity DNA polymerase in a total volume of 25 μL for 32 cycles (95°C for 8 s, 58°C for 20 s and 72°C for 100 s). Amplified PCR products were resolved by agarose gel electrophoresis.
7
MeT-5A Cell Culture and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The immortalized human mesothelial cell line MeT-5A was purchased from the American Type Culture Collection (ATCC), VA, Manassas USA. The cells were cultured in T-25 cell culture flasks using RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin and 100 mg/mL streptomycin. The cultures were maintained in a humidified incubator at 37 °C with 5% CO2. The cells were harvested by trypsinization at 70–80% confluence, and pelleted by centrifuging at 2000× g for 5 min. The RNA was isolated from the pelleted cells using a Monarch total RNA miniprep kit (Cat # T2010S, New England Biolabs, Notting Hill, Australia) following the manufacturer’s protocol. The purified RNA was finally eluted in nuclease-free water. The quality and quantity of the RNA were analyzed using a NanoDrop spectrophotometer.
8
Quantitative RT-PCR Analysis of Metabolic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from U2OS cells using the Monarch Total RNA Miniprep kit (New England Biolabs) and reverse‐transcribed using the iScriptTM cDNA Synthesis Kit (Bio‐Rad). cDNAs were subjected to quantitative real‐time PCR using Luna Universal qPCR Master Mix (New England Biolabs). qPCR and data collection were performed using a StepOnePlus Real‐time PCR system (Thermo Fisher Scientific). The following primer pairs were used: human HK2, 5ʹ‐TGGAGATGGAGAATCAGA‐3ʹ/5ʹ‐CCAGGAAACTCTCGTCTA‐3ʹ; G6PD (glucose‐6‐phosphate dehydrogenase), 5ʹ‐CCGGATCGACCACTACCTGGGCAAG‐3ʹ /5ʹ‐GTTCCCCACGTACTGGCCCAGGACCA‐3ʹ; LDHA (lactate dehydrogenase A), 5ʹ‐GGTTGAGAGTGCTTATGA‐3ʹ/5ʹ‐AACACTAAGGAAGACATCA‐3ʹ; MCT4 (monocarboxylate transporter 4), 5ʹ‐ATTGGCCTGGTGCTGCTGATG‐3ʹ/5ʹ‐ CGAGTCTGCAGGAGGCTTGTG‐3ʹ; and HRPT1 (hypoxanthine phosphoribosyltransferase 1), 5ʹ‐TTTGCTTTCCTTGGTCA‐3ʹ /5ʹ‐GCTTGCGACCTTGACCATCT‐3ʹ.
9
Cryptic Exon Detection by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from samples using the Monarch® Total RNA Miniprep Kit (New England Biolabs, #T2010S) and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, #E6560L). cDNA was amplified using primer pairs designed to either target two wildtype sequences on either side of the cryptic exon or one wildtype sequence and another sequence directly in the cryptic exon. Target sequence amplification was performed using Phusion Plus Green PCR Master Mix (Thermo Scientific, #F632L) and a modified touchdown PCR protocol (92 (link)), described below. Amplified targets were then separated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining.
PCR protocol:
We used two types of primer pairs to amplify targets. The first type comprises a primer targeting the cryptic exon and another targeting an adjacent canonical exon, which we term single-band primers. Consequently, RT-PCR amplification would occur only when transcripts containing cryptic exons are in the sample. This leads to the amplification of cryptic exon-containing RNA at low levels. In the second type, both primers bind canonical mRNA flanking the cryptic exon, which we term double-band primers. Accordingly, two potential transcripts are amplified through RT-PCR: the wildtype and the heavier cryptic exon-including one.
Primers utilized to amplify cryptic exons:
PCR protocol:
We used two types of primer pairs to amplify targets. The first type comprises a primer targeting the cryptic exon and another targeting an adjacent canonical exon, which we term single-band primers. Consequently, RT-PCR amplification would occur only when transcripts containing cryptic exons are in the sample. This leads to the amplification of cryptic exon-containing RNA at low levels. In the second type, both primers bind canonical mRNA flanking the cryptic exon, which we term double-band primers. Accordingly, two potential transcripts are amplified through RT-PCR: the wildtype and the heavier cryptic exon-including one.
Primers utilized to amplify cryptic exons:
10
Quantitative Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qPCR) was used to determine the target gene expression on mRNA level. Total RNA in cell lysates was extracted using Monarch® Total RNA Miniprep Kit (New England BioLabs, Ipswich, USA). The concentrations of purified total RNA were detected using the QIAxpert (QIAGEN, Hilden, Germany). cDNA was synthesized using the AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies, Santa Clara, USA). The expression of target genes (JNK1, JNK2, CDK1, CCNB1, CDC25C1, PLK1, CHEK1, CDKN1A, p53, and Wee1) was verified by qPCR using SYBR-Green Master Mix (New England BioLabs) with LightCyter®480 II (Roche Life Science, Mannheim, Germany). Experiments were performed following the manufacturers’ protocols. Primers were supplied by QIAGEN and are listed in the Supplementary Table S1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!