Transzol up kit
The TransZol Up Kit is a laboratory equipment product designed for the extraction and purification of RNA from various biological samples. It provides a simple and efficient method for isolating high-quality RNA for downstream applications, such as gene expression analysis, RT-PCR, and RNA sequencing.
Lab products found in correlation
28 protocols using transzol up kit
Quantitative Reverse Transcription PCR Analysis
Liver RNA Extraction and Gene Expression Analysis
a TransZol Up kit (Transgen biotech, Beijing, China) according to
the manufacturer’s directions. The RNAs (1.0 μg) were
reverse-transcribed to complementary DNA (cDNA) using a TransScript
One-step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech,
Beijing, China). The expression level of G6PC and TBC1D1 genes in rat livers was measured by quantitative
real-time-polymerase chain reaction (PCR). The primer sequences were
as follows: G6PC: forward primer CGTCACCTGTGAGACTGGAC,
reverse primer GCCCAGTATCCCAACCACAA; TBC1D1: forward
primer TCGATGACACCTTCGCCAAA, reverse primer TGGCCAATCGTGAAGAGCAT.
TMV Helicase Gene Expression Modulation
Quantitative Analysis of Gene Expression
qRT-PCR Analysis of Mouse Liver Genes
Quantitative Gene Expression Analysis in Mice
Isolation of Total RNA from Coptis acuminata
Gene Expression Profiling of Gonad Maturation
Longan Gene Expression Analysis
Nematode RNA Extraction and qPCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!