Immediately following STAPUT, testicular cells were lysed with TrizolLS (Thermo Fisher). Total RNA was purified using TrizolLS according to the commercial protocol with the following additions: after the first phase separation, an additional chloroform extraction step of the aqueous layer was performed using Phase-lock Gel heavy tubes (Quanta Biosciences); addition of 1ul Glyco-blue (Thermo Fisher) immediately prior to isopropanol precipitation; two washes of the RNA pellet with 75% ethanol. If the RNA integrity results indicated co-purified genomic DNA, it was removed with the RapidOUT DNA Removal kit (Thermo Fisher). RNA sample quality was confirmed by spectrophotometry (Nanodrop) to determine concentration and chemical purity (A260/230 and A260/280 ratios) and with a Fragment Analyzer (Advanced Analytical) to determine RNA integrity. PolyA+ RNA was isolated with the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). TruSeq-barcoded RNAseq libraries were generated with the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). Each library was quantified with a Qubit 2.0 (dsDNA HS kit; Thermo Fisher) and the size distribution was determined with a Fragment Analyzer (Advanced Analytical) prior to pooling. Libraries were sequenced on a NextSeq500 instrument (Illumina). At least 20 M single-end 75 bp reads were generated per library.
Qubit 2.0 dsdna hs kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Qubit 2.0 dsDNA HS kit is a fluorometric assay used for the quantitation of double-stranded DNA (dsDNA) samples. The kit provides a simple and sensitive method to measure dsDNA concentrations with high accuracy and reproducibility.
Automatically generated - may contain errors
Lab products found in correlation
Fragment analyzer, by Agilent Technologies (10 mentions)
Nextseq 500, by Illumina (5 mentions)
Trizol ls, by Thermo Fisher Scientific (2 mentions)
Nebnext poly a mrna magnetic isolation module, by New England Biolabs (2 mentions)
Nebnext ultra directional rna library prep kit, by New England Biolabs (2 mentions)
Nebnext ultra 2 rna library prep kit, by New England Biolabs (2 mentions)
Nebnext ultra 2 directional rna library prep kit, by New England Biolabs (1 mentions)
Glycoblue, by Thermo Fisher Scientific (1 mentions)
Phase lock gel heavy tubes, by Quanta Biosciences (1 mentions)
Rapidout dna removal kit, by Thermo Fisher Scientific (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
E z n a total rna kit 1, by Omega Bio-Tek (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Nebnext ultra directional rna library preparation kit, by New England Biolabs (1 mentions)
Nebnext small rna library preparation kit, by New England Biolabs (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Small rna seq library prep kit, by Lexogen (1 mentions)
Bluepippin, by Sage Science (1 mentions)
Nebnext ultra rna library prep kit, by New England Biolabs (1 mentions)
Ribozero magnetic gold h m r kit, by Illumina (1 mentions)
11 protocols using qubit 2.0 dsdna hs kit
1
Transcriptome Analysis of Testicular Cells
2
RNA-Seq Transcriptome Analysis Pipeline
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-Seq was performed using the RNA Sequencing Core at Cornell University. TrueSeq-barcoded RNAseq libraries were generated with the NEBNext Ultra Directional RNA Library Prep Kit (NEB). Each library was quantified with a Qubit 2.0 (dsDNA HS kit; Thermo Fisher) and the size distribution was determined using a fragment analyzer (Advanced Analytical) prior to pooling. Libraries were sequenced on the NEXTseq 500. At least 20 M single-end 75 bp reads were generated per library. Reads were trimmed for low quality and adaptor sequences with Cutadapt v1.8. Reads were mapped to the reference genome UCSC hg19 using Tophat v2.0. Cufflinks v2.2 was used to generate FPKM values and to complete statistical analysis on differential gene expression.
3
RNA-seq Library Quantification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each RNA-seq library was quantified with a Qubit 2.0 (dsDNA HS kit; Thermo Fisher) and the size distribution was determined with a Fragment Analyzer (Advanced Analytical) prior to pooling equimolar amounts of each library for sequencing. Libraries were sequenced on a NextSeq500 instrument (Illumina) generating at least 20 M single-end 85 bp reads per library.
4
RNA-seq Library Preparation and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to RNA-seq, RNA quality was determined using an AATI Fragment Analyzer; all of the samples had an RNA quality number >8.5. A NEBNext Ultra II RNA Library Prep Kit (New England Biolabs) was used to generate TruSeq-barcoded RNA-seq libraries. The libraries were quantified with Qubit 2.0 (dsDNA HS kit, Thermo Fisher Scientific) and the size distribution was measured with a Fragment Analyzer (Advanced Analytical) before pooling. NextSeq500 (Illumina) was used for sequencing, and a minimum of 20 M of single-end 75 bp reads per library were obtained. Cutadapt v1.8 was used to trim low-quality reads and adaptor sequences (parameters: m 50-q 20-a AGATCGGAAGAGCACACGTCTGAACTCCAG-match-read-wild cards) [36 ]. TopHat v2.1 was used to map reads to the reference genome (parameters: library-type=fr-firststrandon-no-novel-juncs-G < ref_genes.gtf>) [37 ]. Differential gene expression analysis was conducted using edgeR [38 (link)]. Only genes with at least 2 counts per million in at least three of the samples were retained for analysis.
5
RNAseq Library Preparation for Illumina
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TruSeq-barcoded RNAseq libraries were generated with the NEBNext Ultra Directional RNA Library Prep Kit (New England Biolabs) using 50-100ng rRNA-subtracted RNA. The RNA fragmentation time was adjusted between 0–15 minutes per sample to account for the degree of fragmentation determined by the RNA integrity check. Each library was quantified with Qubit 2.0 (dsDNA HS kit; Thermo Fisher) and the size distribution was determined with a Fragment Analyzer (Advanced Analytical) prior to pooling. All libraries had a similar size distribution, typically with a size peak between 300-400bp. Libraries were sequenced on an Illumina HiSeq2500. At least 20M single-end 100bp reads were generated per library.
6
RNA Sequencing Library Preparation from S2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from S2 cells was extracted using TRIzol reagent (Thermo Fisher Scientific) and then isolated from the aqueous phase using the EZNA total RNA kit I (Omega Bio-tek). The following steps were performed by the Cornell RNA Sequencing Core (Department of Biomedical Sciences, College of Veterinary Medicine, Cornell University). Poly(A)+ RNA was isolated with the NEBNext Poly(A) mRNA magnetic isolation module (New England Biolabs). TruSeq-barcoded RNA-seq libraries were generated with the NEBNext Ultra Directional RNA library preparation kit (New England Biolabs). Each library was quantified with a Qubit 2.0 (dsDNA HS kit, Thermo Fisher Scientific), and the size distribution was determined with a fragment analyzer (Advanced Analytical) prior to pooling.
7
Small RNA Sequencing and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated as described above and the presence of small RNAs (<200-nt fragments) was detected with a fragment analyzer (Advanced Analytical). TrueSeq-barcoded RNA-seq libraries were generated with the NEBNext Small RNA library preparation kit (New England Biolabs) and size selected for insert sizes ∼18–50 bp. Each library was quantified with a Qubit 2.0 (dsDNA HS kit, Thermo Fisher Scientific). For piRNA analysis, reads were trimmed using Trim Galore! and then run through TEsmall small RNA-seq pipeline (O'Neill et al. 2018 (link)) using the default settings.
8
Small RNA Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both plasma and tissue libraries for miRNA analysis by NGS were prepared using the Small RNA-Seq Library Prep Kit (Lexogen, Austria) according to the manufacturer’s instructions. To avoid contamination of adapter dimers and other RNAs out of small non-coding RNA size range we used BluePippin (Sage Science, USA) electrophoresis with a size range of 125 - 160 bp. The results were checked using a High Sensitivity DNA chip on Bioanalyzer 2100 (Agilent Technologies, USA). This ensured a total elimination of adapter dimers and the eluted fragments had peaks of around 144 and 153 bp. The final concentrations were checked using Qubit 2.0 dsDNA HS Kit (Thermo Fisher). The libraries were sequenced on Illumina MiSeq and NextSeq 500.
9
RNA-seq Library Preparation and Sequencing
10
Transcriptome Analysis of Purified PGCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GFP+ PGCs were purified via FACS and total RNA was isolated using Trizol-LS (Thermo Fisher) according to the manufacturer's instructions. RNA quality was assessed by spectrophotometry (Nanodrop) to determine concentration and chemical purity (A260/230 and A260/280 ratios) and with a Fragment Analyzer (Advanced Analytical) to determine RNA integrity. Ribosomal RNA was subtracted by hybridization from total RNA samples using the RiboZero Magnetic Gold H/M/R Kit (Illumina) and the rRNA-subtracted samples were quantified with a Qubit 2.0 (RNA HS Kit; Thermo Fisher). TruSeq-barcoded RNA-seq libraries were generated with the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs) and each library was quantified via Qubit 2.0 (dsDNA HS kit; Thermo Fisher) prior to pooling. For analysis, reads were trimmed to remove adaptor sequences and low quality reads using Cutadapt v1.8 with parameters:
-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAG -match-readwildcards.
Reads were then mapped to the mm10 mouse reference genome/transcriptome using Tophat v2.1. For gene expression analysis, Cufflinks v2.2 (cuffnorm/cuffdiff) was used to generate FPKM values and statistical analysis of differential gene expression (Trapnell et al. 2010) Gene Ontology analyses were conducted using PANTHER Classification System (Mi et al. 2019 ) and heatmaps were generated using heatmapper.ca (Babicki et al. 2016 )
-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAG -match-readwildcards.
Reads were then mapped to the mm10 mouse reference genome/transcriptome using Tophat v2.1. For gene expression analysis, Cufflinks v2.2 (cuffnorm/cuffdiff) was used to generate FPKM values and statistical analysis of differential gene expression (Trapnell et al. 2010) Gene Ontology analyses were conducted using PANTHER Classification System (Mi et al. 2019 ) and heatmaps were generated using heatmapper.ca (Babicki et al. 2016 )
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!