Harvest freshly isolated or cultured purified B cells. Total RNA was extracted from the cell samples using an RNA Easy Fast Tissue/Cell kit (Tiangen, China) and reversed transcribed to cDNA using the miRcute Plus miRNA First-Strand cDNA Kit (Tiangen, China) according to the manufacturer’s protocol. miR-7 TaqMan probe analysis was performed in 7,500 Real-Time PCR (ThermoFisher) using the miRcute Plus miRNA qPCR Kit (Tiangen, China). Expression levels were standardized relative to U6. Total RNA was extracted using the RNeasy Mini Kit (Qiagen, China). Reverse transcription reactions were prepared using the PrimeScript RT reagent kit with gDNA Eraser (Takara, Japan). Real-Time PCR was performed using TB Green Premix TaqⅡ (Takara, Japan). The expression level was standardized as GAPDH. The relative expression of mRNA and miRNA was analyzed by relative quantification (2−ΔΔCT). All values are expressed as mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 8 software.
Rna easy fast tissue cell kit
Manufactured by Tiangen Biotech
Sourced in China
The RNA Easy Fast Tissue/Cell Kit is a laboratory equipment designed for the rapid and efficient extraction and purification of high-quality RNA from various tissue and cell samples. It utilizes a streamlined protocol to isolate RNA without the need for organic solvents or lengthy centrifugation steps.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Fastking gdna dispelling rt supermix, by Tiangen Biotech (4 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
Fastking rt kit, by Tiangen Biotech (3 mentions)
Primescript rt master mix, by Takara Bio (3 mentions)
Qubit 3.0 fluorometer, by Thermo Fisher Scientific (3 mentions)
Abi quantstudio 5 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr select master mix, by Thermo Fisher Scientific (2 mentions)
Talent qpcr premix sybr green, by Tiangen Biotech (2 mentions)
Abi 7500 system, by Thermo Fisher Scientific (2 mentions)
Sybr green qpcr master mix, by Selleck Chemicals (2 mentions)
Fastking rt supermix, by Tiangen Biotech (2 mentions)
Agilent 5400, by Agilent Technologies (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Mircute plus mirna first strand cdna kit, by Tiangen Biotech (1 mentions)
Mircute plus mirna qpcr kit, by Tiangen Biotech (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
45 protocols using rna easy fast tissue cell kit
1
Quantitative Analysis of miR-7 and mRNA
2
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from both BC cell lines and tissues using an RNAeasy Fast Tissue/Cell Kit (TIANGEN, Beijing). Complementary DNA (cDNA) was reverse-transcribed using the RiboSCRIPT mRNA/lncRNA qRT-PCR Starter Kit (Ribobio, Guangzhou, China). SYBR Green PCR Master Mix was used to amplify the cDNA aliquots. GAPDH served as an endogenous control. The sequences of the sense and antisense primers used are listed in Additional file 1 : Table S3.
3
Quantitative Analysis of Gene Expression in Spermatids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the spermatids of Cfap70-KO mice and their littermate wild-type mice using an RNA Easy Fast Tissue/Cell Kit (Tiangen Biotech). Approximately 0.3 mg total RNA was converted into cDNA with a FastKing One-Step RT‒PCR Kit (Tiangen Biotech) according to the manufacturer's instructions. The cDNAs were individually diluted 10-fold to be used as templates for the subsequent real-time fluorescence quantitative PCR with RealUniversal Colour PreMix (SYBR Green) (Tiangen Biotech). Mouse Gapdh was used as an internal control. Qrich2 and Ttll5 mRNA expression was quantified according to the 2−ΔΔCt method. The primers for qRT‒PCR are listed in Table S4 .
4
Quantitative RT-PCR Analysis of Immune Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained from liver or colon tissue using the RNA Easy Fast Tissue/Cell Kit (TIANGEN Biotech, Beijing, China) according to the instructions. cDNA was synthesized from total RNA using the FastKing RT Kit (TIANGEN Biotech, Beijing, China). RT-PCR was performed with SuperReal PreMix Plus (SYBR Green) (TIANGEN Biotech, Beijing, China) by ABI StepOnePlus™ RT-PCR detection system (ABI, Connecticut, USA). GAPDH was used as the endogenous control, and the 2−△△Ct method was used to calculate. The primer sequences are shown in Table1 .
Primer sequences for RT-PCR.
| Name | Primer sequence (5’ → 3’) | |
|---|---|---|
| CD2 | F | TTCCTGGGTAGCTTCTTTCTGC |
| R | TTGGGGATGTTCAGGGTGATG | |
| CD8A | F | AAGAAAATGGACGCCGAACTT |
| R | AAGCCATATAGACAACGAAGGTG | |
| NKG7 | F | TCAAGTCCAGACATTCTTCTCCT |
| R | CACAAGGTTTCATACTCAGCCC | |
| OAS2 | F | CGGGAAACAGCCCTAAGAGG |
| R | AGCGTAGAGGATTGAAGACTGG | |
| IFI44 | F | GACAAGAGGCATTGCTGTGTT |
| R | CGTGTTTGCTGAACCAGGTCT | |
| GAPDH | F | AGGTCGGTGTGAACGGATTTG |
| R | TGTAGACCATGTAGTTGAGGTCA | |
5
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was isolated using the RNA Easy Fast Tissue/Cell Kit (Tiangen, China). After that, RNA was converted to cDNA using All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Transgen, Beijing, China). Real-time PCR was performed using the TB Green™ Premix Ex Taq™ II Kit (Takara, Tokyo, Japan) on an LC480 real-time PCR system (Roche, Basel, Switzerland). Experiments were performed in triplicate. All data were quantified using the 2−ΔΔCT method in relative quantification and normalized to GAPDH mRNA expression. The primer sequences of the target genes are shown in Table 1 .
6
Quantification of Antioxidant and Cell Death Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extricated from kidney samples using the RNA Easy Fast Tissue/Cell Kit (Lot No: DP451; TianGen, Beijing, China) and following the manufacturer’s instructions. RNA was reverse-transcribed into cDNA with the PrimeScript™ RT Master Mix (Lot No: RR036A; Takara, Japan) in accordance with the manufacturer’s protocol. The mRNA levels of SOD2, CAT, RIPK3, MLKL, GAPDH and β-actin were evaluated by the SYBR® Select Master Mix (Lot No: 4,472,908; Applied Biosystems, USA) and ABI QuantStudio 5 Real-Time PCR System (Applied Biosystems, USA) in line with the manufacturer’s instructions. β-actin or GAPDH was used to normalize the expression values of the other genes. Finally, the − 2 ΔΔCT method was used for analysis. The arrays of the gene-specific primers (TsingKe Biotechnology, Beijing, China) used in this research are presented in Table 2 .
gene-specific primers for qRT-PCR
| Gene name | Forward | Reverse |
|---|---|---|
| SOD2 | GCCCAAACCTATCGTGTCCA | AGGGAACCCTAAATGCTGCC |
| CAT | GCAGATACCTGTGAACTGTC | GTAGAATGTCCGCACCTGAG |
| RIPK3 | TCTGTCAAGTTATGGCCTACTGG | GGAACACGACTCCGAACCC |
| MLKL | AATTGTACTCTGGGAAATTGCCA | TCTCCAAGATTCCGTCCACAG |
| GAPDH | GGCAAATTCAACGGCACAGT | CGCTCCTGGAAGATGGTGAT |
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
7
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was carried out using the RNA Easy Fast Tissue/Cell Kit (TIANGEN, DP451). The concentration of cell-free total RNAs was determined using NanoDrop 2000. Subsequently, cDNA was synthesized with the ReverTra Ace qPCR RT Master Mix with gDNA remover (FSQ-301; Toyobo) kit. For quantitative reverse transcription PCR (qRT-PCR), the SYBR Green Kit (Vazyme, Nanjing, China) was employed. GAPDH served as the internal control for normalization. The specific primer sequences can be found in Table S2
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was extracted from the quadriceps muscle and tibialis anterior muscle of mice with RNA Easy Fast Tissue/Cell Kit (TIANGEN, China), and cDNA was synthesized with the FastKing gDNA Dispelling RT SuperMix (TIANGEN, China). The Q-PCR was performed with the FastReal qPCR PreMix (SYBR Green) (TIANGEN, China) using Quant Studio™ 7 Flex (Applied Biosystems, USA). Reaction conditions: 95 °C for 2 min; 40 cycles of 95 °C for 5 s and 60 °C for 15 s. Each sample has three duplications, and the results were processed by ΔΔCt method.
9
Emodin Regulates Neuroinflammation Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following
materials and reagents were used in the study: Emodin (no.: A0044,
Chengdu Must Biotechnology Co., Ltd., China, purity≥98%); anti-MMP9
(no.: Ab38898, Abcam, U.K.); anti-NF-κB p65 (no.: #8242, CST,
USA); anti-IKKβ (no.: #2678, CST, USA); 2,3,5-triphenyl tetrazolium
chloride (no.: T8877-25G, Sigma, USA); hematoxylin and eosin (HE)
staining kit (no.:BP-DL017, SenBeiJia Biological Technology Co., Ltd.
China); HRP-labeled goat anti-rabbit IgG (H + L) (no.: A0208, Beyotime
Biotechnology, China); anti-MMP2 (no.: Ab181286), anti-occludin (no.:
Ab216327), anti-extracellular signal-regulated kinase [ERK1/2 (no.:
Ab184699)], and p-anti-ERK1/2 (no.: Ab214036)—Abcam, U.K.;
IL-6 antibody (no.: DF6087), HIF1A antibody (no./AF1009), claudin-5
(no./AF5216), and VEGFA antibody (no.: DF7470)—Affinity, China;
Alexa Fluor 555-labeled donkey anti-mouse IgG(H + L) (A0460), Triton
X-100 (no.: ST795), and antifade mounting medium (no.: P0126)—Beyotime
Biotechnology, China; neutral balsam (no.: G8590, Beijing Solarbio
Science & Technology Co., Ltd. China); RNA Easy Fast Tissue/Cell
Kit (no.: DP451), FastKing gDNA Dispelling RT SuperMix (no.: KR118),
and Talent qPCR PreMix (SYBR Green) (no.: FP209)—Tiangen Biotech
(Beijing) Co., Ltd, China; anti-GAPDH (no: AF7021, Affinity); and
BCA Protein Assay Kit (no: P0012S, Beyotime Biotechnology, China).
materials and reagents were used in the study: Emodin (no.: A0044,
Chengdu Must Biotechnology Co., Ltd., China, purity≥98%); anti-MMP9
(no.: Ab38898, Abcam, U.K.); anti-NF-κB p65 (no.: #8242, CST,
USA); anti-IKKβ (no.: #2678, CST, USA); 2,3,5-triphenyl tetrazolium
chloride (no.: T8877-25G, Sigma, USA); hematoxylin and eosin (HE)
staining kit (no.:BP-DL017, SenBeiJia Biological Technology Co., Ltd.
China); HRP-labeled goat anti-rabbit IgG (H + L) (no.: A0208, Beyotime
Biotechnology, China); anti-MMP2 (no.: Ab181286), anti-occludin (no.:
Ab216327), anti-extracellular signal-regulated kinase [ERK1/2 (no.:
Ab184699)], and p-anti-ERK1/2 (no.: Ab214036)—Abcam, U.K.;
IL-6 antibody (no.: DF6087), HIF1A antibody (no./AF1009), claudin-5
(no./AF5216), and VEGFA antibody (no.: DF7470)—Affinity, China;
Alexa Fluor 555-labeled donkey anti-mouse IgG(H + L) (A0460), Triton
X-100 (no.: ST795), and antifade mounting medium (no.: P0126)—Beyotime
Biotechnology, China; neutral balsam (no.: G8590, Beijing Solarbio
Science & Technology Co., Ltd. China); RNA Easy Fast Tissue/Cell
Kit (no.: DP451), FastKing gDNA Dispelling RT SuperMix (no.: KR118),
and Talent qPCR PreMix (SYBR Green) (no.: FP209)—Tiangen Biotech
(Beijing) Co., Ltd, China; anti-GAPDH (no: AF7021, Affinity); and
BCA Protein Assay Kit (no: P0012S, Beyotime Biotechnology, China).
10
Evaluation of Gene Expression in GT1-7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were seeded in 6-well plates and treated with E2, Fy, and TCM, as described previously. At the end of the treatment, total RNA was extracted from GT1-7 cells using an RNA Easy Fast Tissue/Cell Kit (TIANGEN BIOTECH Co., Ltd, Beijing, China) according to the manufacturer’s protocol. The RNA samples were quantified using a microplate reader (BioTek Synergy, United States) at 260/280 nm. First-strand cDNA was prepared using 2 μg RNA reverse-transcribed with a FastKing RT Kit (TIANGEN BIOTECH Co., Ltd, Beijing, China). The synthesized first-strand cDNA was stored at −80°C until use. mRNA expression was analyzed using a 7500 Fast Real-Time PCR system (Applied Biosystems, United States) with the following thermocycling conditions: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 60 s. Single-stranded oligonucleotide primer sets were designed (Tianyi Huiyuan, Beijing, China) to target β-actin, Erα, Kiss1, GPR45, GnRH, GnRHR, IGF1, and IGF1R. The primer sequences used for qRT-PCR are listed in Table 1 . Data were analyzed using the 2ΔΔCt method, and mRNA expression was normalized to that of β-actin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!