E coli dh5α

The pEX18Tc suicide plasmid was linearized within the multiple cloning site by restriction digest with EcoRI. The Gibson assembly reaction was performed as described by Gibson et al. [2 (link)]. The procedure is illustrated in Fig. 1. Briefly, the reaction mix contained 10 nM of each amplified upstream and downstream genomic DNA fragment, 5 nM of linearized pEX18Tc plasmid, 0.004 U/μl of T5 exonuclease, 4 U/μl of Taq ligase, 0.0125 U/μl of Q5 DNA polymerase, 5% (W/V) of PEG8000, 1 mM of NAD, 0.25 mM of dNTPs in 1× Q5 DNA polymerase reaction buffer containing 2 mM MgCl₂. Individual reagents or master mix can be acquired from New England Biolabs. The reaction mixture was incubated at 50 °C for 1 h and the resulting ligated plasmid was transformed into high efficiency chemically competent E. coli DH5α (New England Biolabs). Transformants were checked by colony PCR using the universal pEX18 vector primers, which flank the multiple cloning site: forward, 5′ GGCTCGTATGTTGTGTGGAATTGTG 3′ and reverse, 5′ GGATGTGCTGCAAGGCGATTAAG 3′ (annealing temperature: 55 °C). Positive clones were further verified by DNA sequencing (Eurofins Scientific). A colony containing the sequenced deletion suicide vector was inoculated in TB medium with 10 μg/ml tetracycline and shaken at 250 rpm, 37 °C for about 23 h. Plasmid DNA was extracted by QIAprep spin miniprep kit (QIAGEN).

Plasmid pHN1270 harboring the apramycin selectable marker was used as a complementation vector. The nunF gene was amplified from strain In5 genomic DNA by PCR using Phusion High Fidelity Polymerase (Fisher Scientific) and forward (5′‐GGAATTAACCATGCAGTGGTGGTGGTGGTGGTGCTCGAGAGGAGGACCGACCATGAATCG‐3′) and reverse (5′‐AATCTGTATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTAGTTTACGCCCCGATCATCCATTTG‐3′) primers to yield a 931‐bp fragment which was fused by Gibson Assembly^® (NEB) into pHN1270 linearized by NcoI and SpeI and transformed into E. coli DH5α^™ (NEB). Fusion of the amplicon and plasmid was confirmed by restriction digest of plasmid DNA followed by Sanger sequencing (GATC‐Biotech, Konstanz, Germany) to confirm integrity of the DNA sequence. The resultant construct was then transformed into strain In5 by electroporation described earlier. Complementation was tested using the antifungal activity assay described below with the following strains: P. fluorescens In5 WT, ΔnunF with the control empty vector pHN1270 with or without IPTG (2 mmol/L) induction, and ΔnunF with the complementation plasmid pHN1270::nunF with or without IPTG (2 mmol/L) induction. Complementation was performed with biological triplicates and repeated twice.

E. coli DH5α (New England Biolabs) was routinely used for construction of plasmids. Wild-type Ec-lldD and Zm-pdc genes were amplified from genomic DNA (extracted from E. coli MG1655 and Zymomonas mobilis ATCC^® 31821, respectively) by PCR. The used primers are listed in Table S2. The gene Ll-kdcA from Lactococcus lactis B1157-NIZO was codon-optimized for expression in E. coli and synthesized by Eurofins. The resulting DNA fragments were digested with suitable restriction enzymes (Table S2) and cloned into the corresponding sites of pET28a vector system (Novagen) using T4 DNA ligase (Biolabs), thereby adding an N-terminal hexa-His tag. Point mutations were introduced on pET28-derived plasmid by inverse PCR using the primers listed in Table S3. Resulting products were digested by DpnI to remove template DNA and transformed into competent cells. The introduction of desired mutation was verified by sequencing.

Experiments were performed in E. coli DH5-α (NEB), grown in LB-Lennox (Oxoid) (10-g/L casein peptone, 5-g/L yeast extract, 5-g/L NaCl with additional 15-g/L agar for plates) supplemented with 100-µL/mL ampicillin (Sigma-Aldrich). PCR amplifications were performed using Q5 polymerase (NEB). All other necessary enzymes were also purchased from NEB. Primers were ordered from Eurofins Genomics – Sigma-Aldrich. Plasmids and PCR products were purified using the QIAprep Plasmid Miniprep Kit and QiaQuick PCR Purification Kit, respectively (Qiagen). Plasmid Sanger sequencing was performed by Eurofins Genomics. The E. coli codon-optimized sequence of mCherry was a gift from Yanina R. Sevastsyanovich (University of Birmingham).

The chemical competent bacterial strain E. coli-DH5α from New England Biolabs (NEB, USA) was used throughout this study as expression hosts for all reporter gene based experiments, except otherwise mentioned. We used E. coli-DH5α for reporter based up-regulation studies since the level of up-regulation of reporters is indirectly estimated by fluorometric analysis of the translated product. By using Lon and OmpT protease deficient E. coli-DH5α as an expression host, we wanted to counteract red fluorescent protein (RFP) accumulation and thereby making the test system more robust against misinterpretations. The genome-integrated green fluorescent protein (GFP) producing E. coli strain MG1655 was a gift from the Zalatan lab. E. coli BL21(DE3) strain, used for RT-qPCR studies for fkpa, poxB and surA, was purchased from NEB.

APEC strain χ7122 (O78:H9) and E. coli DH5α (New England Biolabs) (Table 1) were cultured on Luria Bertani (LB) agar plates for 16 h at 37 °C. Alternatively, strains were grown for 16 h in LB broth at 37 °C; cultures were shaken at 200 rpm in LB medium at 37 °C. Where necessary, media were supplemented with the appropriate antibiotic for selection (ampicillin 100 μg/ml, kanamycin 50 μg/ml, chloramphenicol 25 μg/ml, and gentamicin 20 μg/ml).Table 1

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant genotype or description	Source or references
Strain
APEC χ7122	Wild type strain	[29 (link)]
APEC χ7122 pgl+	pgl integrant, kanr	[14 (link)]
APEC χ7122 pgl+ ΔwecA::cat	pgl integrant with wecA deleted and replaced with cat, kanr, cmr	This study
Plasmid
pFPV25.1-G-NetB(10)	Plasmid stably maintained in APEC that expresses NetB with 10 PglB target sites under the control of a constitutive rpsM promoter, ampr	[14 (link)]
pFPV25.1-FlpA-10GT	Plasmid stably maintained in APEC that expresses FlpA with 10 PglB target sites under the control of a constitutive rpsM promoter, ampr	This study
pBADλred	λRed recombineering plasmid, ampr	[26 (link)]