Vettest 8008

After the experimental program, the rats were fasted overnight and euthanized under anesthesia using 100 mg/kg body weight (bw) ketamine administered intraperitoneally. Heart blood was collected in two distinctive tubes: one with EDTA (ethylenediamine tetraacetic acid) anticoagulant for glycosylated hemoglobin determination and another deprived of anticoagulant for serum separation.
The biochemical parameters were carried out in an authorized sanitary veterinary laboratory, Synevovet, Chiajna, Romania. ALT, AST, total cholesterol, LDL cholesterol, triglycerides, and creatinine levels were spectrophotometrically assayed using a Cobas Integra 400 plus analyzer, Roche Diagnostics, Indianapolis-Marion County, Indiana, USA. HbA1c measurements were performed using a standardized immunoturbidimetry method (GSP/DCCT; National Glycohemoglobin Standardization Program/Diabetes Control and Complications Trial reference method) with Cobas Integra 6000 analyzer, Roche Diagnostics, Indianapolis-Marion County, Indiana, USA. HDL cholesterol and serum urea activities were determined by a spectrophotometric assay using the same chemistry analyzer. The uric acid and blood urea nitrogen concentrations were measured using VetTest 8008 serum chemistry analyzer (Idexx Laboratories, Westbrook, Maine, USA).

After anesthesia and before euthanasia, 1ml of blood was collected via a puncture
in the abdominal aorta, from both groups (knockout and wild) after 24 hours of
reperfusion.
The samples were centrifuged and the following biochemical parameters were
analyzed: FA, ALT, AST and GGT. The analyses were made in an automatic
biochemical analyzer Vet Test 8008 (QBC Analyzer, IDEXX Laboratories Ltd,
Chalfont St Peter, UK).

RGEM/Cas9 NLRP3 Knockout mice was established from Macrogen (Seoul, Korea). Target RGEM site was located in exon 2 of NLRP3 gene and four target sequences was used (RG1 (down) AGCAGCCCTTTCGAGGGTCTCGG, RG2 (up) GACGAGTGTCCGTTGC AAGC TGG, RG3 (up) CATGATTGACTTCAATGGCGAGG, RG4 (up) GGATCTTTGCTGCG ATC AACAGG). Six kinds of NLRP3 Knock out mutant mice were obtained and confirmed using genotyping with NLRP3 PCR primers. After identification of KO deletion type, mice line, which has large deletion site (>200 bp) of NLRP3, was selected. Male WT and NLRP3 KO mice (NLRP3^−/−) (aged 8–10 weeks; n = 6 per group) underwent left ureteral ligation as described previously (19 (link)). Complete ureteral obstruction was produced by double ligation with 4-0 silk thread. These mice comprised the WT/UUO and NLRP3^−/−/UUO groups, respectively. Comparable groups of male mice underwent an identical procedure without ligation as the WT/Sham group and NLRP3^−/−/Sham groups (n = 6 per group). Mice were sacrificed on days 7 after UUO and the serum and kidney were collected. The level of blood urea nitrogen (BUN) and serum creatinine was determined using a VetTest 8008 (IDEXX Laboratories, Westbrook, ME, USA). All experiments were performed according to the guidelines of the hospital animal research ethics committee (KHNCM AP 2018-004).

Plasma creatinine levels were measured by liquid chromatography electron spray ionization and tandem mass spectrometry (LC/ESI/MS) using an Agilent 6410 MS coupled with 1200 LC system (Agilent, New Castle, DE), as described previously [35 ]. Briefly, 5 μl of plasma (n=11, each group) and 5 μl of deuterated creatinine (10 pmol/μl) were added into 90 μl of 20 mM ammonium acetate solution, subjected to protein precipitation by 85% acetonitrile. 2 μl of the supernatant was then injected for LC/MS analysis. A hydrophilic interaction chromatography (HILIC) was performed utilizing Luna Phenomenex column (2.1 × 150mm, 3μm; Torrance, CA)) with an isocratic gradient of 85% acetonitrile with 20 mM ammonium acetate for 5 min at flow rate of 0.3 mL/min. The ion transition of the m/z 114 to m/z 44 for creatinine and m/z 117 to m/z 47 for D₃-creatinine was monitored in the multiple reaction monitoring (MRM) mode. The creatinine concentration in each plasma sample was determined by comparing the peak areas of the creatinine and D₃-creatinine for the above transitions. Blood urea nitrogen (BUN) was measured directly on IDEXX VetTest 8008 chemistry analyzer (Westbrook, Maine) using dry slide technology.

For the determination of hematological and biochemical parameters, blood samples were collected from six pigs per treatment, prior to slaughter, on the last day of the trial (day 40). Feed was removed from the feeders 4 h before blood sampling. A sample of 4 mL of blood was collected from the jugular vein of the pigs and placed in vacutainer tubes with ethylenediamine tetra acetic acid (EDTA). Hematological parameters (hemoglobin; erythrocytes; hematocrit, HCT; leucocytes; lymphocytes) were determined using an automated analyzer MS4 (Melet Schloesing Lab, Osny, France) and biochemical parameters (albumin, ALB; alanine aminotransferase, ALT; aspartate aminotransferase, AST; cholesterol, CHOL; creatine kinase, CK; glucose, GLU; total bilirubin, TBIL; triglycerides; TRIG) in serum using the IDEXX VETTEST 8008 (IDEXX LAB, Westbrook, ME, USA).