The largest database of trusted experimental protocols

44 protocols using 5z 7 oxozeaenol

1

Inducing Apoptosis in Cells via Modulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant mouse mTNFα (T) (Cell sciences Cat# CRT192C) was resuspended in PBS at a concentration of 100 μg/ml. zVAD.fmk (Z) (Sigma, Cat# V116) was dissolved in DMSO at a concentration of 20 mM and used at a final concentration of 20 μM. Cycloheximide (Sigma, Cat# C-6255) was resuspended in DMSO at a concentration of 10 mg/ml and used as indicated. 7-Cl-O-Nec-1 (Nec-1s) was made by custom synthesis, dissolved in DMSO at a concentration of 10 mM and used at a final concentration of 10 μM. Custom-synthesized (Selleckchem) Smac mimetic SM-164 54 was resuspended in DMSO at a concentration of 10 mM and used at a final concentration of 500 nM. 5Z-7-Oxozeaenol (Sigma, Cat# 09890) was dissolved in DMSO at a concentration of 25 mM and used at a final concentration of 500 nM.
+ Open protocol
+ Expand
2

Alveolar Macrophage and Fibroblast Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rat alveolar macrophage NR8383 cells (CRL-2192, ATCC, Manassas, VA, USA) were cultured at 37 °C in a humidified environment containing 5% CO2 in Ham’s F-12K (Kaighn’s) medium (Life Technologies, Grand Island, NY, USA), supplemented with 15% fetal bovine serum (FBS) (Life Technologies). Human lung fibroblast WI-38 cells (ATCC; no. CCL-75) were cultured at 37 °C in a humidified environment containing 5% CO2 in Eagle's minimum essential medium (ATCC) supplemented with 10% FBS and 100 U ml–1 penicillin–streptomycin (Life Technologies). Resveratrol with a purity ⩾99% (high-performance liquid chromatography (HPLC)) and 5Z-7-oxozeaenol with a purity ⩾98% (HPLC) were purchased from Sigma (St Louis, MO, USA). Chalcone derivative (4′-hydroxychalcone) with a purity ⩾98% (HPLC) was purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Silica particles, silicon dioxide (SiO2), with an average diameter of 1.6 μm were purchased from US Silica MIN-U-SIL-5, US Silica, Shanghai, China. Human recombinant TGF-β (TGF-β1) was purchased from Merck Millipore (Danvers, MA, USA). Cross-species TAK1 siRNA and NC siRNA were purchased from Cell Signaling Technology (Danvers, MA, USA) and transfected into cells using the Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. SIRT1 Activity Assay Kit was from Abcam (Cambridge, MA, USA).
+ Open protocol
+ Expand
3

Inhibition of TAK1 Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
The TAK1 inhibitor 5Z-7-oxozeaenol (Sigma) was diluted in dimethyl sulfoxide (DMSO) and used at a concentration of 300 nM. Puromycin and hygromycin (Sigma) were used at 5 μg/ml and 50 μg/ml, respectively. Mouse anti-c-Myc and anti-β-actin antibodies were from Sigma. Rabbit anti-TAK1 and anti-β-tubulin antibodies were from Cell Signaling Technologies.
+ Open protocol
+ Expand
4

Intracerebroventricular Delivery of TAK1 Inhibitor

Check if the same lab product or an alternative is used in the 5 most similar protocols
The specific TAK1 inhibitor (5Z‐7‐oxozeaenol; Sigma‐Aldrich, O9890) was dissolved in dimethyl sulfoxide (DMSO, Sigma‐Aldrich, D2650) (0.8 μg/μL), as previously described.25 2 μL of 5Z‐7‐oxozeaenol solution was administered into the intracerebroventricular of non‐transgenic and CARD3‐TG mice 30 minutes before tMCAO through stereotaxic apparatus (Stoelting, Wood Dale, IL, 51900). An equal volume of DMSO was administered as control treatment.
+ Open protocol
+ Expand
5

Detailed Antibody-Based Immunoassay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Details of the Abs used are included in Supplemental Table I. Abs were obtained from the following companies: Cell Signaling Technology (Beverly, MA), Santa Cruz Biotechnology (Santa Cruz, CA), Jackson Immunoresearch Laboratory (West Grove, PA), Southern Biotech (Birmingham, AL), abcam (Cambridge, MA), Biolegend (San Diego, CA), and BD Biosciences (San Jose, CA). PMA was purchased from LC laboratories (Woburn, MA). 5Z-7-Oxozeaenol and LPS (E.coli 0111: B4) were purchased from Sigma (St. Louis, MO). All chemicals were dissolved in H2O or DMSO. DMSO was titrated to determine its effect on B cell function including B cell proliferation, CSR, AID expression and others. When DMSO was diluted more than 1:1000, it had no effects on B cell function. Because all chemicals were used at 1:2000 to 1:100,000 dilution from stocks, vehicle controls were not included in these assays.
+ Open protocol
+ Expand
6

Modulation of A431 Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
A431 cells were cultured in DMEM with 1% penicillin/streptomycin, 1% Amphotericin B (Corning, Oneonta NY) and 10% FBS (Sigma, St. Loius, MO). Cells were transfected with control siRNA, two different DP-specific siRNA (target sequences: ACCGUCACUGAGCUAGUAGAUUCTG and AAGUUUGCUAUUCUGGCAAUAAACT), or p38a MAPK siRNA (target sequence: CAUUACAACCAGACAGUUGAUAU) using DharmaFect (Dharmacon, Lafayette, CO) according to manufacturer’s protocols. Where indicated, A431 cells were treated with the following drugs purchased from Sigma: 5Z-7-oxozeaenol (4 μM), MT4 (1 μM), EHT1864 (25 μM), Y27632 (1 μM), CN01 (1 U/mL).
+ Open protocol
+ Expand
7

Modulation of Cell Death Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipopolysaccharide (LPS) Escherichia coli 011:B4 (10 ng/ml, L4391), 5Z-7-Oxozeaenol (5z7, 125 nM), Necrostatin-1 (Nec-1, 10 uM, N9037) and cycloheximide (CHX, 10ug/ml) were purchased from Sigma. zVAD.fmk was purchased from Millipore (2109007, 50uM). Caspase-3/7 inhibitor I was purchased from Cayman Chemical. Recombinant human and murine TNF (50ng/ml) was purchased from PeproTech. SMAC mimetic SM-164 (1uM) was purchased from ApexBio.
+ Open protocol
+ Expand
8

Influenza A Virus Infection in MEFs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Murine embryonic fibroblasts (MEFs) were obtained from 13- to 14-days-old WT mouse embryos digested with 0.5% trypsin-EDTA solution for 30 minutes at 37°C [24 (link)]. MEFs were cultured in MEM supplemented with 20% heat inactivated FBS. Cells were pretreated for 30 minutes with specific TAK1 inhibitor 5Z-7-oxozeaenol (1 μM) (Sigma-Aldrich, Oakville, ON, Canada), infected with Influenza A virus at 0.5 multiplicity of infection (m.o.i.) and treated with placebo or LTB4 (1 μM). Cells were also stimulated with MDP alone (10 μg/ml) or in combination with LTB4 (1 μM). Supernatants and cells were collected 6 hours post-treatment. Protein samples were extracted from cells and assayed for western blot analyses, as detailed above, using anti-IPS–1, anti-phospho-IRF3, anti-phospho-IRF7 and anti-NF-κB p65 antibodies. Supernatants were assayed for IFNβ, TNFα and IL–6 by ELISA.
+ Open protocol
+ Expand
9

Disrupting IRF3 and NF-kB Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pharmacological synthetic inhibitors were used to block the proteins that regulate interferon regulatory factors (IRFs) and NF-kB downstream signalling pathways. The TBK1-mediated activation of IRF3 was blocked by 0.1 μM BX795 [30 (link)], IkB kinase (IKK)-mediated NF-kB activation by 10 nM PS1145 [31 (link)] and TAK1 activation by 0.1 μM 5Z-7-oxozeaenol [32 (link)] (Sigma-Aldrich, Stockholm, Sweden). The cells were incubated at 37°C for 1 h in the presence of all inhibitors and then infected with 1 MOI RV1B for 24 h.
+ Open protocol
+ Expand
10

Antibody Panel for ADAM12 and Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were employed in this study: mouse ADAM12 (Proteintech 14139-1-AP); human ADAM12 (Sigma HPA030867); human TAK1 (SCBT sc-1839); human KAT2A (SCBT sc-20698); human SIRT6 (Abcam ab62739); human SMAD3 (ab28379), human phospho-SMAD3 (Abcam ab52903), human tubulin (Abcam ab7291), human TAB1 (CST 3226); human Histone H3 (CST 2650). TGF-β was from Proteintech and the TAK1 inhibitor (5Z)-7-oxozeaenol from Sigma.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!