cDNA of Lin28b and Ldlr were amplified and cloned into p3×Flag-CMV-10. After that, the cDNA of flag-Lin28b and flag-Ldlr were cloned into lenti-EF1α-MCS-T2A-Hygro viral expression vector. The CRISPR/Cas9-resistant plasmids are synonymous mutations of a clustered randomly regularly interspaced short palindromic repeats (CRISPR)–Cas9 sequence with a Fast mutagenesis kit (Vazyme, #C214-01). the CRISPR/Cas9-resistant wild-type Lin28b (flag-Lin28b-WT(r)) plasmid sequence changes ‘ATACGGGTAACAGGCCCAGG’ to ‘ATTCGCGTTACAGGCCCAGG’. The mutant Lin28b (flag-Lin28b-MU(r)) sequence are mutations of (flag-Lin28b-WT(r) sequence with a Fast mutagenesis kit (Vazyme, #C215-01). Five point-mutations (W34A, F43A, F61A, H159A and H181A) spread across the cold shock domain (CSD) and CysCysHisCys (CCHC) zinc-finger RNA-binding motifs were created in flag-Lin28b-MU(r) that render the protein incapable of let-7 suppression21 (link).
Fast mutagenesis kit
Manufactured by Vazyme
Sourced in China
The Fast Mutagenesis Kit is a product developed by Vazyme for performing efficient site-directed mutagenesis. It provides a streamlined workflow for introducing specific mutations into DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Psicheck 2 plasmid, by Promega (3 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (3 mentions)
Psicheck 2, by Promega (2 mentions)
Reporter assay system kit, by Promega (2 mentions)
Plvx ires zsgreen, by Takara Bio (2 mentions)
Psicheck 2 vector, by Promega (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Hiscribe t7 arca mrna kit, by New England Biolabs (2 mentions)
Pten sirna, by GenePharma (2 mentions)
Flag myc cmv 24 vector, by Merck Group (1 mentions)
Pgl3 basic luciferase plasmid, by Promega (1 mentions)
Dual luciferase reporter assay kit, by Vazyme (1 mentions)
Prl tk, by Promega (1 mentions)
Hilymax, by Dojindo Laboratories (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Mirna inhibitor, by GenePharma (1 mentions)
Rnai oligonucleotide, by GenePharma (1 mentions)
Bl21 de3 cells, by Transgene (1 mentions)
Gel extraction kit, by Omega Bio-Tek (1 mentions)
Plx304 fos v5, by Addgene (1 mentions)
19 protocols using fast mutagenesis kit
1
Engineered Lin28b Protein Variants
2
Engineered Ezrin and ROCK2 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The development of bacterial expression vectors containing human ezrin fused to histidine was described previously61 (link). EGFP-tagged ezrin plasmids was produced as described before62 (link). PCR amplified ROCK2 cDNA was cloned into the 3× FLAG-Myc-CMV-24 vector (Sigma) by BamHI and RcoRI digestion. The mutanted of ezrin and ROCK2 were constructed by Fast Mutagenesis Kit (Vazyme Biotech). All plasmids were verified by sequencing (Tsingke Biological Tech).
3
Cloning and Mutagenesis of CBLB/GRB2 3'-UTRs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′-UTRs of CBLB/GRB2 in Fig. 5a containing miR-27b putative target sites were amplified and cloned into psiCHECK-2 (Promega). A Fast Mutagenesis kit (VazymeBioTech) was used to mutate the miR-27b-binding sites of the CBLB and GRB2 3′-UTR vectors in Fig. 5a according to the manufacturer’s instructions. Dual-luciferase assays were performed using 1 × 104 Bads-200 cells per well in a 96-well plate. Following attachment for 8 h, the cells were co-transfected with 50 ng respective reporter constructs with either miR-27b or NC (50 nM). After 48 h, the Reporter Assay System Kit (Promega, 017319) was used to measure the luciferase activity. Each transfectant was assayed in triplicates. Firefly luciferase activity was normalized to constitutiverenilla luciferase activity.
4
Plasmid Construction and Gene Knockout Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIP12 complementary DNA (cDNA) (NM_001284214.2) was a generous gift from Jiahuai Han’s lab (Xiamen University, China). TRIP12 cDNA was cloned into pCMV-flag or pCMV-myc vector. TRIP12 mutants were generated by Fast Mutagenesis Kit (Vazyme, Nanjing, China) following the manufacturer’s instructions. The pENTER-NFATc1-flag plasmid was purchased from Vigene Biosciences (Shandong, China) and NFATc1 (NM_172390.3) was subcloned into pCMV-myc vector. The pCMV-ubiquitin (Ub)-HA, pcDNA3.1-WARS-flag, pcDNA3.1-SIRT1/2/3/4/5/6/7-HA plasmids were constructed previously in our laboratory. Tryptophanyl-tRNA synthetase (WARS) (NM_173701.2) cDNA was cloned into pCMV-flag or pCMV-myc vector to obtain WARS expression plasmids. The sgRNAs for WARS/TRIP12 KO were inserted into pSpCas9(BB)-2A-Puro vector and the sgRNAs for TRIP12 knockin were inserted into pSpCas9(BB)-2A-GFP. All constructs were confirmed by sequencing.
5
NANOG Promoter Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 2000 bp promoter region of NANOG was cloned into pGL3-Basic Luciferase plasmid (Promega, USA, #E1751) to generate pGL3-Basic-NANOG wild-type plasmid. Subsequently, a pGL3-Basic region-3 deletion of NANOG promoter plasmid was constructed using Fast Mutagenesis Kit (Vazyme, #C214-01). To access the luciferase activity, the Dual Luciferase Reporter Assay Kit (Vazyme, #DL101-01) was employed in HEK-293T cells transfected with the Firefly luciferase and Renilla luciferase plasmids (pRL-TK, Promega, #E2241).
6
Validating miR-630 Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the candidate target genes predicted by bioinformatics analysis are targets of miR-630, 3′UTRs of ARFGEF2, PDGFRA, SET, MTDH and EP300 containing the miR-630 binding site were amplified from the human genomic DNA using primers ARFGEF2-UTR-F/R, PDGFRA-UTR-F/R, SET-UTR-F/R, MTDH-UTR-F/R, severally (Supplementary Table S1 ), and then were cloned into the downstream of Renilla luciferase gene in the psiCHECK™-2 vector (Promega). Mutant MTDH-UTR plasmid containing three mutated bases on the predicted binding site was constructed using the fast mutagenesis kit (Vazyme) with primers MTDH-UTR-mut-F/R.
To stably overexpress mature miR-630 in MDA-231-D3H2LN cells, the DNA fraction containing the mature sequence of miR-630 was amplified with primers miR-630-F/R (Supplementary Table S1 ) from the model plasmid pcDNATM6.2-GWSW/miR-630 kindly provided by Prof, Min-Liang Kuo (National Taiwan University) and then was cloned into the lentiviral expression plasmid pLVX-IRESZsGreen (Clontech Laboratories). The pcDNA3.1-MTDH plasmid was structured previously in our lab [25 (link)].
For co-expression of microRNA mimics and its target-genes, the target-gene MTDH was transfected using Hily Max (Dojindo, Kumamoto, Japan) firstly, and after 24 hours the microRNA mimics were transfected using Lipofectamine 2000 reagent (Invitrogen).
To stably overexpress mature miR-630 in MDA-231-D3H2LN cells, the DNA fraction containing the mature sequence of miR-630 was amplified with primers miR-630-F/R (
For co-expression of microRNA mimics and its target-genes, the target-gene MTDH was transfected using Hily Max (Dojindo, Kumamoto, Japan) firstly, and after 24 hours the microRNA mimics were transfected using Lipofectamine 2000 reagent (Invitrogen).
7
Investigating circKLF4 in Mouse Dermal Papilla Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of circKLF4 siRNA oligonucleotides (circKLF4-si) (GenePharma) are 5′-UGGGGGAAGUCGCUUGUUGTT-3′ (sense) and 5′-CAACAAGCGACUUCCCCCATT-3′ (anti-sense). Silencer select negative control siRNA (GenePharma) was used as the control. Dicer siRNA oligonucleotides were purchased from Thermo.
The circKLF4 sequence was cloned into the pcDNA 3.1 (+) circRNA Mini Vector (P-vector) to construct its overexpression plasmid (P-circKLF4). The mutated circKLF4 plasmids (P-circKLF4-Mut-1895 and P-circKLF4-Mut-5046) were created using the Fast Mutagenesis Kit (Vazyme).
After 3–4 days’ culture of mDPCs, siRNA, miRNA inhibitor (30 pmol, GenePharma) and wild type or mutant circKLF4 plasmid were co-transfected into cells with Lipofectamine 2,000 (Invitrogen).
The circKLF4 sequence was cloned into the pcDNA 3.1 (+) circRNA Mini Vector (P-vector) to construct its overexpression plasmid (P-circKLF4). The mutated circKLF4 plasmids (P-circKLF4-Mut-1895 and P-circKLF4-Mut-5046) were created using the Fast Mutagenesis Kit (Vazyme).
After 3–4 days’ culture of mDPCs, siRNA, miRNA inhibitor (30 pmol, GenePharma) and wild type or mutant circKLF4 plasmid were co-transfected into cells with Lipofectamine 2,000 (Invitrogen).
8
Validation of miR-494 Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the possibility of miR-494 targeting predicted candidate gene, 3′UTR of APC, Rab5A and PAK1 containing miR-494 binding site were cloned into the downstream of Renilla luciferase gene in the psiCHECK-2 vector (Promega). Mutant PAK1-3′UTR containing single mutated base and double mutated base sites were constructed using fast mutagenesis kit (Vazyme, shanghai, China). For PAK1 overexpressing, PAK1 was cloned into the pcDNA3.1. And pri-494 was cloned into the lentiviral expression plasmid pLVX-IRES-ZSGreen (Clontech Laboratories, CA, USA) for miR-494 stable overexpressing.
9
HPV L1 Expression and Pseudovirus Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HPV6 (GenBank: AAC80442.1 ), HPV11 (AAA46935.1 ), HPV16 (ANA05496 ), HPV18 (AAQ92369 ), HPV31 (P17388 ), HPV26 (NP_041787.1 ), HPV33 (AMY16565 ), HPV35 (P27232 ), HPV39 (P24838 ), HPV45 (P36741 ), HPV51 (ACV88631.1 ), HPV52 (AML80965 ), HPV53 (NP_041848 ), HPV56 (P36743 ), HPV58 (AFS33402 ), HPV59 (CAA54856 ), HPV66 (ABO76893 ), HPV68 (AGU90787 ), HPV69 (AHV83654.1 ), and HPV70 (P50793 ) L1 genes were used for L1 expression and pseudovirus preparation. N-terminally truncated HPV6, –11, –16, –18, –31, –33, –35, –45, –52, –58, and –59 L1 genes were cloned into pTO-T7 vector30 (link). A series of site-directed mutations on HPV L1-C175 and -C428 were created using the Fast Mutagenesis Kit (Vazyme, Nanjing, China). These mutated HPV L1 genes were cloned into the pTO-T7 expression vector53 and the E.coli ER2566 strain was used for protein expression. The HPV52 L1/L2 genes were synthesized by GLS (GL Biochem, Shanghai, China). All the C175A/C428A mutations in the L1 genes were generated using the Fast Mutagenesis Kit. The phylogenetics of HPV L1 proteins was analyzed by MEGA 10.1.7.
10
Cloning and Knockdown of MAD1 and ULK1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA of MAD1 was amplified and cloned into p3xFLAG-CMV-10, pEGFP-C1 and pET28a vectors. ΔN (Δ1-485a.a.), ΔMIM (Δ485-584a.a.) and ΔC (Δ584-718a.a.) of MAD1 were amplified and cloned into pEGFP-C1 vector. ΔN (Δ1-278a.a.), ΔST (Δ278-828a.a.) and ΔC (Δ828-1051a.a.) of ULK1 were amplified and cloned into p3xFLAG-CMV-10 vector. For expression of MAD1–MAD2, cDNA of MAD1 and MAD2 was amplified and cloned into pETDuet-1 vectors. pETDuet-1 vector was kindly provided by Dr Caihong Yun (Peking University Health Science Center, China). MAD1 and ULK1 mutation constructs were generated with a Fast mutagenesis kit (Vazyme).
The sense-strand sequence of negative control siRNA was 5′-UUCUCCGAACGUGUCACGU-3′. The other siRNA sequences were as follows:
ULK1: 5′-CACTGACCTGCTCCTTAA-3′ (#1) and 5′-GGAGAAAACTTGTAGGTGT-3′ (#2).
ZW10: 5′-UGAUCAAUGUGCUGUUCAA-3′ (#1) and 5′-AAGGGTGAGGTGTGCAATATG-3′ (#2).
Knl1:5′-GGAAUCCAAUGCUUUGAGA-3′ (#1) and 5′-GCAUGUAUCUCUUAAGGAA-3′ (#2).
MAD1:5′-CAGGCAGUGUCAGCAGAAC-3′ (#1) and 5′-CCACAGGGCAGCAGCAUGA-3′ (#2).
For MAD1 knockdown, siRNA was transfected twice in 2 days. All RNAi oligonucleotides were purchased from Shanghai GenePharma Company.
The sense-strand sequence of negative control siRNA was 5′-UUCUCCGAACGUGUCACGU-3′. The other siRNA sequences were as follows:
ULK1: 5′-CACTGACCTGCTCCTTAA-3′ (#1) and 5′-GGAGAAAACTTGTAGGTGT-3′ (#2).
ZW10: 5′-UGAUCAAUGUGCUGUUCAA-3′ (#1) and 5′-AAGGGTGAGGTGTGCAATATG-3′ (#2).
Knl1:5′-GGAAUCCAAUGCUUUGAGA-3′ (#1) and 5′-GCAUGUAUCUCUUAAGGAA-3′ (#2).
MAD1:5′-CAGGCAGUGUCAGCAGAAC-3′ (#1) and 5′-CCACAGGGCAGCAGCAUGA-3′ (#2).
For MAD1 knockdown, siRNA was transfected twice in 2 days. All RNAi oligonucleotides were purchased from Shanghai GenePharma Company.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!