Log In Sign up
The largest database of trusted experimental protocols

Pgl4.51 luc2 cmv neo plasmid

Manufactured by Promega
Visit Supplier

The PGL4.51[luc2/CMV/Neo] plasmid is a laboratory tool designed for gene expression studies. It contains the luc2 luciferase reporter gene under the control of the CMV promoter and a neomycin resistance gene for selection purposes.

Automatically generated - may contain errors

Lab products found in correlation

Dneasy blood and tissue kit, by Qiagen (1 mentions) Hek293, by American Type Culture Collection (1 mentions) Skov3, by American Type Culture Collection (1 mentions) Ovcar8, by American Type Culture Collection (1 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

PGL4.51[luc2/CMV/Neo] (7 citations) Luc2/CMV/Neo (5 citations) PGL4.51 plasmid (2 citations)

4 protocols using pgl4.51 luc2 cmv neo plasmid

1

Metformin Inhibits Lung Tumor Growth

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 cells were stably transfected (pooled neomycin-resistant population) with pGL4.51[luc2/CMV/Neo] plasmid (Promega) to generate A549Luc2 cells. The cell suspension in DMEM containing 10% Matrigel at a density of 2 × 106 cells/0.1 ml was injected intratracheally into the lungs of female nude mice. Post one week of injection, mice were administered metformin (5 mg/ml) in the drinking water. Tumors were allowed to develop for 5 weeks. For weekly luciferase imaging, mice were anaesthetized using Ketamine (80 mg/Kg) and Xylaxine (10 mg/Kg) by intraperitoneal injection. Anaesthetized mice were intraperitoneally injected D-luciferin (150 mg/Kg). Imaging was performed using Kodak imaging system FX Pro and images were analyzed using Carestream imaging software. Post 5 weeks, the mice were euthanized. Primary tumors were excised and western blot analysis was performed as described earlier. The liver was harvested and ex vivo imaging was performed.
Genomic DNA was isolated from blood obtained from euthanized mice for analyzing circulating tumor cells using the DNeasy Blood and Tissue Kit (Qiagen). qPCR was performed using primers specific to the human Alu repeat sequence (Forward: ACGCCTGTAATCCCAGCACTT, Reverse: TCGCCCAGGCTGGAGTGC), while mouse actin served as the control (Forward: GCTTCTTTGCAGCTCCTTCGTTG, Reverse: TTTGCACATGCCGGAGCCGTTGT).
Kumari R., Deshmukh R.S, & Das S. (2019). Caspase-10 inhibits ATP-citrate lyase-mediated metabolic and epigenetic reprogramming to suppress tumorigenesis. Nature Communications, 10, 4255.
+ Open protocol
+ Expand
2

Establishing DU145-Luc2 Xenograft Model for Metastasis Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols
DU145 cells were transfected with the pGL4.51 [luc2/CMV/Neo] plasmid (Promega) and selected with 500 μg/ml G418. Two weeks later, single-cell colonies that stably expressed bioluminescence signals were selected using the IVIS 100 Imaging System (Xenogen). A clone (DU145-Luc2, #9) was used in the mouse xenograft studies. DU145-Luc2 cells were infected with viruses containing shScramble or shJARID1D-4. Cells were selected for at least three days using puromycin.
The cells were injected into the tail veins of 6- to 8-week-old male athymic nu/nu mice (1 × 106 cells per mouse) obtained from The University of Texas MD Anderson Cancer Center. After cell implantation, metastasized loci and tumor growth were monitored using the IVIS 100 Imaging System. Eight to ten weeks after implantation, the mice were humanely euthanized, and their lung tissues were collected for standard histological examination. MD Anderson's Institutional Animal Care and Use Committee approved the care and use of the mice used in these experiments.
Li N., Dhar S.S., Chen T.Y., Kan P.Y., Wei Y., Kim J.H., Chan C.H., Lin H.K., Hung M.C, & Lee M.G. (2016). JARID1D is a suppressor and prognostic marker of prostate cancer invasion and metastasis. Cancer research, 76(4), 831-843.
+ Open protocol
+ Expand
3

Establishing a DU145-Luc2 Xenograft Model

Check if the same lab product or an alternative is used in the 5 most similar protocols
DU145 cells were transfected with pGL4.51[luc2/CMV/Neo] plasmid (Promega) and selected with 500 μg/ml G418. Two weeks later, single cell colonies that stably expressed luciferase and showed chemiluminescence signals upon luciferin treatment were selected using the IVIS 100 Imaging System (Xenogen). The clone DU145-Luc2 #9 was used in mouse xenograft studies. Male nu/nu mice (6-8 weeks old) were purchased from The University of Texas MD Anderson Cancer Center (Houston, Texas). DU145-Luc2 #9 cells were infected with viruses containing shScramble or shZMYND8-97. Cells were selected for at least 3 days using puromycin. Cells (1 × 106 per mouse) were injected via the tail veins. Mice were monitored using the IVIS 100 System after implantation. Eight weeks later, they were euthanized, and lung tissues were collected for standard histological examination. All animals used and studied were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Texas MD Anderson Cancer Center.
Li N., Li Y., Lv J., Zheng X., Wen H., Shen H., Zhu G., Chen T.Y., Dhar S.S., Kan P.Y., Wang Z., Shiekhattar R., Shi X., Lan F., Chen K., Li W., Li H, & Lee M.G. (2016). ZMYND8 reads the dual histone mark H3K4me1-H3K14ac to antagonize the expression of metastasis-linked genes. Molecular cell, 63(3), 470-484.
+ Open protocol
+ Expand
4

Establishment of Luciferase-Expressing OVCAR8 Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lines including OVCAR8, SKOV3, OCC1, ES2 and HEK293 cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA). Luciferase stable OVCAR8 cell line was developed by our laboratory. OVCAR8 cells were transfected with PGL4.51[luc2/CMV/neo] plasmid (Promega) by Lipofectamine 3000 reagent (Invitrogen) following the manufacture procedures. After 72 h transfection, cells were selected by adding 400µg/ml G418 antibiotic in DMEM containing 10% fetal bovine serum. After 1-month culture, luciferase activity in transfected cells was confirmed with One-Step Glow Assay kit (Fisher Scientific).
Zheng J., Zhao S., Yu X., Huang S, & Liu H.Y. (2017). Simultaneous targeting of CD44 and EpCAM with a bispecific aptamer effectively inhibits intraperitoneal ovarian cancer growth. Theranostics, 7(5), 1373-1388.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!