Pfuultra 2 hf dna polymerase

pcDNA3.1 vectors expressing FLAG-tagged mouse hnRNPC were generated as follows. First, total RNA was prepared from KP7B (mouse lung carcinoma) cells using RNeasy purification kit (QIAGEN) and was used to synthesize cDNAs using SuperScript cDNA Synthesis System (Thermo Fisher). cDNAs were used as templates in PCR reactions using PfuUltra II HF DNA polymerase (Agilent) and the following primers: 5′-GCCCATAAGCTTATGGACTACAAAGACGATGACGACAAGGCTAGCAATGTTACCAACAAGACA GATCCTCGG-3′ (forward) and 5′-GCCCATTCTAGATTATTAAGAGTCATCCTCCCCATTGGCGCTGTCTCTG-3′ (reverse). Restriction sites for HindIII (in forward primer) and XbaI (in reverse primer) are in bold. Sequences encoding FLAG are underlined. The PCR products were cleaved with the indicated restriction enzymes (New England BioLabs Inc), purified (QIAquick PCR Purification Kit, QIAGEN) and cloned into pcDNA3.1 vectors. The integrity of the plasmids were confirmed by sequencing (Eton Bioscience, Inc.).
Attractene (QIAGEN) transfection was performed following manufacturer instructions using 4 g of DNA (empty pcDNA3.1 vector or vector expressing FLAG-tagged mouse hnRNPC) and 15 μL of Attractene Reagent per 10cm plate. 24 hours after transfection, cells were given fresh media. Cells were then treated with cisplatin as described in a previous section.

pcDNA3.1 vectors expressing FLAG-tagged human hnRNPC were generated as follows. First, total RNA was prepared from BT20 (human breast carcinoma) cells using RNeasy purification kit (QIAGEN) and was used to synthesize cDNAs using SuperScript cDNA Synthesis System (Thermo Fisher). cDNAs were used as templates in PCR reactions using PfuUltra II HF DNA polymerase (Agilent) and the following primers: 5′-CCATAAGCTTATGGACTACAAAGACGATGACGACAAGTCAGGCGGATCCGCCAGCAACGTTAC CAACAAGACAGATCC-3′ (forward) and 5′-TCAGGAATTCTTAAGAGTCATCCTCGCCATTGGC-3′ (reverse). Restriction sites for HindIII (in forward primer) and EcoR1 (in reverse primer) are in bold. Sequences encoding FLAG are underlined. The PCR products were cleaved with the indicated restriction enzymes (New England BioLabs Inc), purified (QIAquick PCR Purification Kit, QIAGEN) and cloned into pcDNA3.1 vectors. The integrity of the plasmids were confirmed by sequencing (Eton Bioscience, Inc.).
X-tremeGENE 9 (Sigma Aldrich) transfection was performed following manufacturer instructions with a 3:1 ratio of transfection reagent to DNA. 5Âμg of DNA (empty pcDNA3.1 vector or vector expressing FLAG-tagged human hnRNPC) was transfected per 10cm plate. 24 hours after transfection, cells were given fresh media. Cells were then treated with cisplatin as described in a previous section.