The largest database of trusted experimental protocols

Kapa probe fast qpcr mastermix 2x

Manufactured by Roche
Sourced in United Kingdom, United States

KAPA PROBE FAST qPCR MasterMix (2X) is a pre-mixed, ready-to-use solution for quantitative polymerase chain reaction (qPCR) assays. It is designed to enable fast and sensitive detection of target DNA sequences.

Automatically generated - may contain errors

2 protocols using kapa probe fast qpcr mastermix 2x

1

Metabolic Profiling of Cell Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols
All reagents were obtained from Life Technologies (Paisley, UK) unless otherwise stated. Fetal bovine serum (FBS) and HS were purchased from Seralab (Haywards Heath, UK). DC protein assay, TGX gels and midi transfer packs were all purchased from Bio‐Rad (Hemel Hempstead, UK). BLUeye Prestained Protein Ladder was purchased from Geneflow (Lichfield, UK). LONG® R3 insulin‐like growth factor (IGF)‐1 (human) was purchased from Sigma‐Aldrich (Gillingham, UK). Anti‐pan Akt and anti‐p‐Akt (serine 473) were purchased from Cell Signaling Technologies (MA, USA), anti‐β‐actin from Abcam (Cambridge, UK) and anti‐apoB from Santa Cruz Biotechnology (CA, USA). Amicon Ultra Centrifugal Filter units were purchased from Millipore (Watford, UK). RNEasy® Plus mini kit was purchased from QIAGEN Sciences (Manchester, UK) and KAPA PROBE FAST qPCR MasterMix (2X) from Kapa Biosystems (London, UK). Taqman probes were purchased from Applied Biosystems (Hemel Hempstead, UK). TAG, lactate and 3‐hydroxybutyrate (3‐OHB) assays were from Instrumentation Laboratory UK (Cheshire, UK). Heavy water (2H2O) was purchased from CK Isotopes (Ibstock, UK) and gas chromatography (GC) standards were from Sigma‐Aldrich (Gillingham, UK).
+ Open protocol
+ Expand
2

Quantification of DPAGT1 mRNA expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from PD002 (~106) cells using a RNeasy Mini kit (Qiagen, Inc., Valencia, CA, USA) after the treatment with CPPB or tunicamycin (0–10 μM) for 24h. Expression was measured by Kapa probe fast qPCR Master Mix (2X) (KAPA BIOSYSTEMS; Wilmington, MA, USA) with S19 as an endogenous control. Primer sequences were as follow; DPAGT1, forward, 5’‐tcagggacaaagagatctgga‐3’; reverse, 5’‐cagcatggtttgttctaatgctt‐3’. The PCR cycling conditions were performed with total 45 cycles at 95 °C for 10sec and 60 °C for 10sec, 72 °C for 10sec, and cooled down at 40 °C for 30sec. Relative mRNA expression changes were calculated by the 2-ΔΔCq method.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!