Total RNA from human tissues, HEK293-OATP1B3, and DLD-1 was extracted using the ABI RNA isolation system (Applied Biosystems, Foster City, CA), similar to the approach published previously [27 (link), 28 (link)]. TaqMan real-time RT-PCR was conducted using an ABI Prism 7700 system (Applied Biosystems, Foster City, CA) to determine the mRNA levels of Lt- and Ct-OATP1B3, as described previously [27 (link), 28 (link)]. The PCR primers were designed to distinguish the cDNA of Lt- from Ct-OATP1B3, based on a previous publication [17 (link)]. GAPDH was used as internal control for ovarian tissues, whereas 18S ribosomal RNA was used as internal control for prostate, breast, bladder, and lung tissues. The TaqMan probe and primers sequences (5’−3’) are summarized in Table 1 . Fold changes in mRNA levels of examined tissues and cells were evaluated after normalizing the gene expression levels by their respective internal control (2−ΔΔCt method), as previously described [29 (link)].
Abi rna isolation system
Manufactured by Thermo Fisher Scientific
The ABI RNA isolation system is a laboratory equipment designed to extract and purify RNA from various biological samples. It utilizes a proprietary technology to efficiently isolate high-quality RNA while minimizing contamination. The system is intended for use in research and diagnostic applications.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using abi rna isolation system
1
Quantification of OATP1B3 mRNA Isoforms
2
Quantitative Analysis of Bcrp mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell lysates using the ABI RNA isolation
system (Applied Biosystems, Foster City, CA). mRNA levels of rat Bcrp
and β-actin (internal control) were measured by TaqMan real-time
RT-PCR using an ABI Prism 7700 System (Applied Biosystems) as described
previously.29 (link) The TaqMan probe and primer
sequences (5′–3′) used for rat Bcrp were as follows:
forward (TGGATTGCCAGGCGTTCATT),
reverse (GTCCCAGTATGACTGTAACAA),
and probe (CTGCTCGGGAATCCTCAAGCTTCTG).
Rat β-actin was detected using the following probe and primer
sequences: forward (TGCCTGACGGTCAGGTCA),
reverse (CAGGAAGGAAGGCTGGAAG),
and probe (CACTAATCGGCAATGAGCGGTTCCG).
Fold changes in mRNA levels of Bcrp were evaluated after normalizing
the gene expression levels by those of β-actin (2–ΔΔCt method) as previously described.30 (link)
system (Applied Biosystems, Foster City, CA). mRNA levels of rat Bcrp
and β-actin (internal control) were measured by TaqMan real-time
RT-PCR using an ABI Prism 7700 System (Applied Biosystems) as described
previously.29 (link) The TaqMan probe and primer
sequences (5′–3′) used for rat Bcrp were as follows:
forward (TGGATTGCCAGGCGTTCATT),
reverse (GTCCCAGTATGACTGTAACAA),
and probe (CTGCTCGGGAATCCTCAAGCTTCTG).
Rat β-actin was detected using the following probe and primer
sequences: forward (TGCCTGACGGTCAGGTCA),
reverse (CAGGAAGGAAGGCTGGAAG),
and probe (CACTAATCGGCAATGAGCGGTTCCG).
Fold changes in mRNA levels of Bcrp were evaluated after normalizing
the gene expression levels by those of β-actin (2–ΔΔCt method) as previously described.30 (link)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!