Cfx96 c1000 touch system

Two hundred testes per condition after dissection were frozen at −80°C in fresh Trizol buffer (Trizol Life Technologies, 15596026; 5 μg Linear Poly-Acrylamide Sigma 56575, 100ηg of tRNA). Total RNA was extracted pooling testes samples, followed by 5 rounds of freezing (liquid nitrogen)/thawing at 37°C in a water bath. Then 5 Vortex rounds at RT for 30”, letting stand at RT for 5 min to disrupt all RNA-protein complexes. Finally, RNA was isolated by phenol/chloroform extraction.
Purified RNA was treated with DNase Q1 (Promega, M610A). RNA (1 mg) from testes dissected from 3 do control or EGFR^DN or Fos^WT+EGFR^DN flies (genotypes: c587-Gal4/Y; tub-Gal80^TS/+; +/+, c587-Gal4/Y; tub-Gal80^TS/+; UAS-EGFR^DN/UAS-TdTomato or c587-Gal4/Y; tub-Gal80^TS/UAS-Fos^WT; UAS-EGFR^DN/+) was reverse-transcribed using the iScriptkit (Bio-Rad, 170–8841). Standard qPCRs were carried out on a Bio-Rad CFX96/C1000 Touch system (Bio-Rad), using Sso Advanced SYBR Green (Bio-Rad, 1725–264). The following primer sequences were used: Act5c Fwd: TTGTCTGGGCAAGAGGATCAG; Act5cRev: ACC ACTCGCACTTGCACTTTC; Atg6 Fwd: CGACAATGAGTGAGGCGGAA; Atg6 Rev: TCTCCGTAGATGGGCAAAGA. Cycling conditions were as follows: 95°C for 30 s; 95°C for 5 s then 55°C for 30 s, cycled 40 times. All calculated gene expression values were normalized to the value of the loading control gene, Actin5c.

RNA (2 μg) from posterior midguts dissected from RU486 (RU+)- or ethanol (RU−)-fed flies (genotypes: Su(H)lacZ; esg-GFP, 5966GAL4^GS crossed to UAS-Gli^RNAi) was reverse-transcribed using the iScriptkit (Bio-Rad, 170–8841). Standard qPCRs were carried out on a Bio-Rad CFX96/C1000 Touch system (Bio-Rad), using Sso Advanced SYBR Green (Bio-Rad, 1725–264). The following primer sequences were used: RpL32 Fwd: 5′-ATCGTGAAGAAGCGCACCAA3′; RpL32 Rev: 5′-TGTCGATACCCTTGGGC TTG-3′; Gli Fwd: 5′-GCCGAATCGTCCAATTACAG-3′; Gli Rev: 5′-ACTTTAAA GAAAAATTCCAGGAGAAA-3′; Puc Fwd: 5′-CGACTTTATCGAAGATGCACG G-3′ Puc Rev: 5′-CAGGGAGAGCGACTTGTACC-3′. Expression levels of targets analysed were calculated relative to RpL32 expression, using the ∆∆Ct method.