Total RNA was extracted from cultured cells or frozen adipose tissue using the Eastep Super Total RNA Extraction Kit (Promega (Beijing) Biotech Co., China). The absorbance ratio at 260/280 nm and the RNA concentration of each sample were detected using a NanoDrop ND2000 spectrophotometer (Thermo Scientific). Reverse transcription was performed using the PrimeScript Reverse Transcript Master Mix (TaKaRa, Japan). qPCR was performed using a QuantStudio Dx Real-Time PCR Instrument (Applied Biosystems). The comparative ΔΔCt method was used to evaluate the relative mRNA levels; 36B4 served as the reference gene (Supplementary Table 1
Primescript reverse transcript master mix
Manufactured by Takara Bio
Sourced in Japan
PrimeScript Reverse Transcript Master Mix is a reagent used for the reverse transcription of RNA to cDNA. It contains all the necessary components for efficient and sensitive cDNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Eastep super total rna extraction kit, by Promega (4 mentions)
Quantstudio dx real time pcr instrument, by Thermo Fisher Scientific (3 mentions)
Nanodrop nd 2000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Rna extraction reagent, by Vazyme (1 mentions)
Quantstudio real time pcr system, by Thermo Fisher Scientific (1 mentions)
Total rna extraction reagent, by Vazyme (1 mentions)
Sybr green qpcr master mix, by Vazyme (1 mentions)
Nanodrop nd 2000, by Thermo Fisher Scientific (1 mentions)
6 protocols using primescript reverse transcript master mix
1
Quantifying Adipose Tissue Gene Expression
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction reagent (Vazyme Biotech, Nanjing, China) was used to extract the total RNA from the sample of interest. The concentration and purity of RNA were measured using a NanoDrop spectrophotometer. Then, PrimeScript Reverse TranscriptMasterMix (TaKaRa, Otsu, Japan) was employed to conduct reverse transcription. Subsequently, QuantStudio Real-Time PCR system (Thermo Fisher, Waltham, USA) was utilized to perform qRT-PCR. Details of Primer sequences are listed in Additional file 2 : Table S1. The relative mRNA expression was assessed using the ΔΔCT method.
3
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells using the RNA isolator Total RNA Extraction Reagent (Vazyme, Shanghai, China). The RNA concentration and absorbance ratio at 260/280 nm of all samples were detected using a NanoDrop ND2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Reverse transcription was performed using the PrimeScript™ Reverse TranscriptMasterMix (TaKaRa Bio, Otsu, Japan). qPCR was conducted using the QuantStudio™Dx Real-Time PCR Instrument (Applied Biosystems, Foster City, CA, USA). The ΔΔCT method was used to evaluate the relative mRNA expression which was normalized to β-actin. The experiment was replicated three times. Primer sequences are listed in Table S5 .
4
Intestinal Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen intestinal tissue using the EastepTM Super Total RNA Extraction Kit (Promega Biotech Co., China) and reverse transcribed to cDNA using PrimeScript Reverse Transcript Master Mix (TaKaRa, Japan). Real-time quantitative PCR was performed using Applied Biosystems QuantStudioDx (Thermo Fisher Scientific, USA) with the universal SYBR Green qPCR Master Mix (Vazyme Biotech, China). The following primers were used: 18S, forward TTCTGGCCAACGGTCTAGACAAC, reverse CCAGTGGTCTTGGTGTGCA; GPR120, forward GGCACTGCTGGCTTTCATA, reverse GATTTCTCCTATGCGGTTGG; SCLT1, forward CGGAAGAAGGCATCTGAGAA, reverse AATCAGCACGAGGATGAACA; TGR5, forward ACCATCAGGGCTACTGGTCC, reverse GCCATGTAGCGTTCCCCAT; FXR, forward TGGGCTCCGAATCCTCTTAGA, reverse TGGTCCTCAAATAAGATCCTTGG. All the samples were run in duplicate in a 384-well reaction plate. The comparative ∆∆CT method was used to evaluate the relative mRNA levels of the housekeeping gene 18S.
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cultured cells using Eastep® Super Total RNA Extraction Kit (Promega, Beijing, China) according to the manufacturer’s instructions. The RNA concentration and absorbance ratio at 260/280 nm of all samples were checked using a NanoDrop ND2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Reverse transcription was performed using the PrimeScript™ Reverse TranscriptMasterMix (TaKaRa Bio, Otsu, Japan). qPCR was conducted using the QuantStudio™Dx Real-Time PCR Instrument (Applied Biosystems, Foster City, CA, USA). The comparative computed tomography (CT) method was used to evaluate the relative messenger RNA (mRNA) levels and relative gene expression which was normalized to 36b4. Primer sequences are listed in Table S5 .
6
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells or frozen adipose tissue using the Eastep Super Total RNA Extraction Kit (Promega (Beijing) Biotech Co., China). The absorbance ratio at 260/280 nm and the RNA concentration of each sample were detected using a NanoDrop ND2000 spectrophotometer (Thermo Scientific). Reverse transcription was performed using the PrimeScript Reverse Transcript Master Mix (TaKaRa, Japan). Quantitative PCR was performed using a QuantStudio Dx Real-Time PCR Instrument (Applied Biosystems Instrument). The comparative 2 -△△ CT method was used to evaluate the relative mRNA levels; 36B4 served as the reference gene. Primers used for PCR are listed in Table S2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!